Incidental Mutation 'R4397:Prss38'
ID325547
Institutional Source Beutler Lab
Gene Symbol Prss38
Ensembl Gene ENSMUSG00000049291
Gene Nameprotease, serine 38
SynonymsGm249, LOC216797
MMRRC Submission 041685-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R4397 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location59372669-59375657 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59373028 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 286 (Y286C)
Ref Sequence ENSEMBL: ENSMUSP00000052010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061481]
Predicted Effect probably damaging
Transcript: ENSMUST00000061481
AA Change: Y286C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052010
Gene: ENSMUSG00000049291
AA Change: Y286C

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Tryp_SPc 55 284 7.08e-75 SMART
low complexity region 288 305 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133698
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (55/57)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg4 T G X: 56,932,343 L2193V probably damaging Het
Agap2 G A 10: 127,090,483 A866T unknown Het
Aig1 A C 10: 13,652,982 S237A probably benign Het
Baz1b C T 5: 135,244,446 R1475W probably damaging Het
Bmp1 C T 14: 70,490,542 probably null Het
Crybg3 A G 16: 59,560,095 probably benign Het
Dnajc15 T C 14: 77,874,794 probably null Het
Fam135b T A 15: 71,448,676 H1334L probably benign Het
Fancg A T 4: 43,008,897 H113Q probably benign Het
Gfap G A 11: 102,896,984 A45V probably benign Het
Gjd3 A T 11: 98,982,421 L199Q probably damaging Het
Gm8979 A G 7: 106,082,923 noncoding transcript Het
H13 A G 2: 152,677,552 D65G probably damaging Het
Hcls1 T C 16: 36,937,300 V5A possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Homer3 G A 8: 70,290,143 probably null Het
Iqgap3 T C 3: 88,104,358 Y817H probably damaging Het
Iqsec2 C T X: 152,209,053 T562I probably damaging Het
Klb A G 5: 65,380,039 Y904C probably damaging Het
Kremen1 A T 11: 5,199,610 S354T probably benign Het
Lamc3 A G 2: 31,931,952 E1304G probably benign Het
Lrp4 T C 2: 91,511,670 V1876A probably benign Het
Magi3 T C 3: 104,219,714 T85A probably damaging Het
Map3k12 C T 15: 102,501,259 A694T probably benign Het
Mex3b T C 7: 82,869,823 S449P possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nars2 T C 7: 96,973,564 probably null Het
Nlrp1a T G 11: 71,097,204 M1046L probably benign Het
Nphs1 T G 7: 30,481,965 probably null Het
Nup133 G A 8: 123,944,301 T119M probably benign Het
Olfr770 G T 10: 129,133,581 N62K possibly damaging Het
Pcdhga9 A T 18: 37,738,641 I508F probably damaging Het
Phactr3 A G 2: 178,175,406 probably benign Het
Plcb3 T C 19: 6,965,825 K155E probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Psg16 T C 7: 17,090,698 S45P possibly damaging Het
Ptpn21 G T 12: 98,688,248 P820Q probably damaging Het
Ptpn21 A G 12: 98,715,060 V105A probably damaging Het
Rnf7 A G 9: 96,478,410 M58T probably benign Het
Slc25a11 G A 11: 70,644,851 A287V probably benign Het
Slit2 G T 5: 48,220,081 probably null Het
Suco A G 1: 161,844,852 Y460H probably damaging Het
Tnxb C T 17: 34,678,662 Q804* probably null Het
Trpv6 A G 6: 41,625,238 I379T possibly damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Virma A G 4: 11,513,901 E585G possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Vmn2r88 A T 14: 51,417,978 D549V probably damaging Het
Other mutations in Prss38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03075:Prss38 APN 11 59373055 missense probably damaging 1.00
LCD18:Prss38 UTSW 11 59375641 utr 5 prime probably benign
R0001:Prss38 UTSW 11 59373180 splice site probably benign
R0097:Prss38 UTSW 11 59375608 missense possibly damaging 0.86
R0097:Prss38 UTSW 11 59375608 missense possibly damaging 0.86
R0540:Prss38 UTSW 11 59375543 missense possibly damaging 0.50
R0607:Prss38 UTSW 11 59375543 missense possibly damaging 0.50
R1966:Prss38 UTSW 11 59373484 missense probably damaging 1.00
R4394:Prss38 UTSW 11 59373028 missense probably damaging 1.00
R4529:Prss38 UTSW 11 59373499 missense probably damaging 1.00
R4738:Prss38 UTSW 11 59372945 missense probably benign 0.00
R5061:Prss38 UTSW 11 59374370 missense probably damaging 0.98
R5219:Prss38 UTSW 11 59375483 splice site probably benign
R5306:Prss38 UTSW 11 59372995 missense probably benign 0.00
R6894:Prss38 UTSW 11 59373024 missense probably benign 0.19
R7286:Prss38 UTSW 11 59375558 missense probably benign 0.00
R7860:Prss38 UTSW 11 59375170 missense probably damaging 1.00
T0970:Prss38 UTSW 11 59373148 missense possibly damaging 0.81
Z1176:Prss38 UTSW 11 59374334 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGTGTCCTGACTTCATGGAAC -3'
(R):5'- GGGCATACCTGGTCTAGTAGATC -3'

Sequencing Primer
(F):5'- TGCGTGGAAGCAGGATTTGAG -3'
(R):5'- CCTGGTCTAGTAGATCACAGAAAGC -3'
Posted On2015-07-06