Incidental Mutation 'R0012:Add2'
ID32555
Institutional Source Beutler Lab
Gene Symbol Add2
Ensembl Gene ENSMUSG00000030000
Gene Nameadducin 2 (beta)
Synonyms
MMRRC Submission 038307-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.226) question?
Stock #R0012 (G1)
Quality Score208
Status Validated
Chromosome6
Chromosomal Location86028681-86124409 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86098628 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 253 (V253E)
Ref Sequence ENSEMBL: ENSMUSP00000145034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032069] [ENSMUST00000203196] [ENSMUST00000203279] [ENSMUST00000203366] [ENSMUST00000203724] [ENSMUST00000203786] [ENSMUST00000204059] [ENSMUST00000205034]
Predicted Effect probably damaging
Transcript: ENSMUST00000032069
AA Change: V253E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032069
Gene: ENSMUSG00000030000
AA Change: V253E

DomainStartEndE-ValueType
Aldolase_II 135 317 2.9e-48 SMART
coiled coil region 558 585 N/A INTRINSIC
low complexity region 687 725 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203196
AA Change: V253E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145104
Gene: ENSMUSG00000030000
AA Change: V253E

DomainStartEndE-ValueType
Aldolase_II 135 317 2.9e-48 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203279
AA Change: V253E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145452
Gene: ENSMUSG00000030000
AA Change: V253E

DomainStartEndE-ValueType
Aldolase_II 135 289 1.77e-20 SMART
coiled coil region 310 337 N/A INTRINSIC
low complexity region 439 477 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203366
AA Change: V253E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144849
Gene: ENSMUSG00000030000
AA Change: V253E

DomainStartEndE-ValueType
Aldolase_II 135 317 2.9e-48 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203529
Predicted Effect probably damaging
Transcript: ENSMUST00000203724
AA Change: V253E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145296
Gene: ENSMUSG00000030000
AA Change: V253E

DomainStartEndE-ValueType
Aldolase_II 135 317 2.9e-48 SMART
coiled coil region 558 585 N/A INTRINSIC
low complexity region 687 725 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203786
AA Change: V253E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144694
Gene: ENSMUSG00000030000
AA Change: V253E

DomainStartEndE-ValueType
Aldolase_II 135 317 2.9e-48 SMART
coiled coil region 558 585 N/A INTRINSIC
low complexity region 687 725 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000204059
AA Change: V253E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145160
Gene: ENSMUSG00000030000
AA Change: V253E

DomainStartEndE-ValueType
Aldolase_II 135 317 2.9e-48 SMART
coiled coil region 558 585 N/A INTRINSIC
low complexity region 687 725 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000205034
AA Change: V253E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145034
Gene: ENSMUSG00000030000
AA Change: V253E

DomainStartEndE-ValueType
Aldolase_II 135 317 2.9e-48 SMART
Meta Mutation Damage Score 0.8388 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.7%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: This gene encodes the beta subunit of the adducin family. Adducins, encoded by alpha, beta and gamma genes, are heteromeric proteins that crosslink actin filaments with spectrin at the cytoskeletal membrane. This protein, primarily found in the brain and hematopoietic cells, is regulated by phosphorylation and calmodulin interactions as it promotes spectrin assembly onto actin filaments, bundles actin and caps barbed ends of actin filaments. In mouse, deficiency of this gene can lead to mild hemolytic anemia and impaired synaptic plasticity. Mutations of this gene in mouse serve as a pathophysiological model for hereditary spherocytosis and hereditary elliptocytosis. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display mild anemia with compensated hemolysis, marked alteration in osmotic fragility, predominant presence of elliptocytes in the blood and increased blood pressure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam33 A T 2: 131,052,920 L687Q probably damaging Het
Adap1 A G 5: 139,307,734 probably benign Het
Agtr1a A T 13: 30,381,749 I266F probably damaging Het
Anxa9 A G 3: 95,308,095 probably benign Het
Arap2 G A 5: 62,683,484 L680F probably damaging Het
Asna1 T C 8: 85,025,096 probably benign Het
Bnip3 A G 7: 138,898,672 probably benign Het
Brwd1 A C 16: 96,059,652 S311R probably damaging Het
C2cd3 G A 7: 100,418,522 V871M possibly damaging Het
Cacul1 A G 19: 60,564,253 W145R probably damaging Het
Celf5 C A 10: 81,469,512 V141L probably damaging Het
Cfap206 C A 4: 34,714,519 L392F possibly damaging Het
Chd2 G T 7: 73,455,519 T192K probably damaging Het
Chrna10 T C 7: 102,115,057 N40S possibly damaging Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Clspn T A 4: 126,564,929 probably benign Het
Clstn1 G A 4: 149,634,796 V361M probably damaging Het
Col5a3 A T 9: 20,777,108 probably benign Het
Copb1 T A 7: 114,237,408 K366N probably damaging Het
Cul9 G A 17: 46,538,510 R570C probably benign Het
Cyp2c70 A T 19: 40,187,243 L7Q probably null Het
Dock2 T C 11: 34,783,795 E10G possibly damaging Het
Dpysl4 T G 7: 139,097,883 I412S probably benign Het
Eaf2 T A 16: 36,808,174 probably benign Het
Fasl T C 1: 161,788,164 D41G probably benign Het
Fat2 A G 11: 55,262,871 V3505A probably benign Het
Fbxo24 A G 5: 137,621,994 F101S probably damaging Het
Fdft1 T C 14: 63,177,698 I28M probably benign Het
Gcnt3 T C 9: 70,034,085 I400M probably benign Het
Gpd2 T A 2: 57,338,868 M228K probably damaging Het
Gsap T A 5: 21,226,229 probably benign Het
Hipk1 A G 3: 103,763,680 M467T probably damaging Het
Hmgb4 T A 4: 128,260,725 I17F probably damaging Het
Ints10 C A 8: 68,807,475 L284M probably benign Het
Kif17 T G 4: 138,293,748 S606A probably damaging Het
Lifr C A 15: 7,175,608 T442K possibly damaging Het
Lypd4 A G 7: 24,865,332 L127P probably damaging Het
Lyst A G 13: 13,687,694 H2605R probably benign Het
Map3k4 A G 17: 12,238,189 S1289P probably damaging Het
Mgam T A 6: 40,765,256 probably null Het
Mob1b G A 5: 88,756,084 probably benign Het
Mrgpra1 A G 7: 47,335,470 S154P probably damaging Het
Ms4a4c C A 19: 11,418,980 probably benign Het
Mthfd2l A T 5: 90,961,383 H224L probably damaging Het
Myh8 T C 11: 67,300,021 Y1350H probably benign Het
Nectin2 T C 7: 19,730,744 probably benign Het
Nos1 A C 5: 117,893,902 N305T probably damaging Het
Ogfrl1 T A 1: 23,370,125 Q340L possibly damaging Het
Olfr1318 A T 2: 112,156,826 N292Y possibly damaging Het
Olfr1502 C A 19: 13,861,823 T10K probably damaging Het
Olfr170 T C 16: 19,606,440 N76S probably benign Het
Olfr427 T G 1: 174,100,207 F250V probably damaging Het
Orc1 T C 4: 108,595,646 probably null Het
Plekhg5 C A 4: 152,104,750 D249E probably benign Het
Plet1 A G 9: 50,499,130 I74V probably benign Het
Psmd2 T A 16: 20,661,684 D718E probably damaging Het
Rab33b G T 3: 51,484,316 probably benign Het
Rae1 T A 2: 173,002,673 F4I unknown Het
Ralgapa2 A G 2: 146,412,752 Y821H probably benign Het
Scd2 G A 19: 44,301,246 V227I probably benign Het
Sharpin G T 15: 76,348,343 P156T possibly damaging Het
Slc38a4 C T 15: 96,999,629 R435H probably damaging Het
Snrnp200 T C 2: 127,228,549 V1061A probably benign Het
Suclg1 A G 6: 73,270,997 T234A possibly damaging Het
Swsap1 T C 9: 21,957,022 C197R probably benign Het
Tbx15 A G 3: 99,352,096 T428A probably benign Het
Tet2 T C 3: 133,476,558 Y1215C probably damaging Het
Tjp1 A G 7: 65,329,775 probably benign Het
Tmem209 G T 6: 30,502,113 probably benign Het
Tnpo3 T C 6: 29,589,177 E58G probably damaging Het
Trp53bp2 T A 1: 182,444,718 M464K probably damaging Het
Ttc32 A G 12: 9,035,897 Y148C possibly damaging Het
Unc80 T C 1: 66,507,391 S541P probably damaging Het
Ushbp1 T C 8: 71,395,040 probably benign Het
Vmn2r100 A G 17: 19,504,874 M22V probably benign Het
Vmn2r100 A T 17: 19,526,034 E485V probably damaging Het
Wdr24 G A 17: 25,827,113 V471I probably benign Het
Zfp35 T A 18: 24,002,944 M115K probably benign Het
Zfp429 G A 13: 67,390,677 S216L probably benign Het
Zfp644 T G 5: 106,635,043 E1155A probably benign Het
Other mutations in Add2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02689:Add2 APN 6 86107406 missense possibly damaging 0.94
IGL02799:Add2 UTSW 6 86106252 missense possibly damaging 0.65
R0448:Add2 UTSW 6 86092919 missense probably benign 0.05
R0452:Add2 UTSW 6 86104629 nonsense probably null
R0834:Add2 UTSW 6 86086917 missense probably damaging 0.99
R1220:Add2 UTSW 6 86087000 missense possibly damaging 0.92
R1598:Add2 UTSW 6 86098646 missense probably benign 0.03
R1806:Add2 UTSW 6 86118657 missense probably damaging 0.96
R1837:Add2 UTSW 6 86118558 missense probably damaging 1.00
R1959:Add2 UTSW 6 86096756 missense probably damaging 1.00
R1961:Add2 UTSW 6 86096756 missense probably damaging 1.00
R2152:Add2 UTSW 6 86098598 missense probably damaging 1.00
R2309:Add2 UTSW 6 86096801 missense probably damaging 1.00
R4744:Add2 UTSW 6 86110888 missense probably damaging 1.00
R4789:Add2 UTSW 6 86118770 missense probably benign 0.04
R4896:Add2 UTSW 6 86096746 missense probably benign 0.03
R4989:Add2 UTSW 6 86110858 missense probably benign 0.10
R5004:Add2 UTSW 6 86096746 missense probably benign 0.03
R5061:Add2 UTSW 6 86087047 splice site probably null
R5068:Add2 UTSW 6 86107458 missense probably damaging 0.97
R5405:Add2 UTSW 6 86101197 missense probably benign 0.09
R5418:Add2 UTSW 6 86110912 missense probably benign 0.00
R5576:Add2 UTSW 6 86107475 critical splice donor site probably null
R5952:Add2 UTSW 6 86109746 missense probably damaging 1.00
R6011:Add2 UTSW 6 86098625 missense probably damaging 1.00
R6031:Add2 UTSW 6 86098673 missense probably damaging 1.00
R6031:Add2 UTSW 6 86098673 missense probably damaging 1.00
R7026:Add2 UTSW 6 86086983 missense probably benign 0.39
R7158:Add2 UTSW 6 86085952 missense probably damaging 1.00
R7387:Add2 UTSW 6 86086015 missense probably damaging 1.00
R7393:Add2 UTSW 6 86098647 nonsense probably null
R7487:Add2 UTSW 6 86093450 missense possibly damaging 0.94
R7511:Add2 UTSW 6 86098615 missense probably benign
R7543:Add2 UTSW 6 86106225 missense probably damaging 1.00
Z1088:Add2 UTSW 6 86085965 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTCCTTACAGCCTTGGAGTGATGTG -3'
(R):5'- TCTGTGACAGCGTCTGACAGTACC -3'

Sequencing Primer
(F):5'- TGAGAAGCCCTTAGAGTCCTCAG -3'
(R):5'- GCGTCTGACAGTACCACTCC -3'
Posted On2013-05-09