Incidental Mutation 'R4397:Gjd3'
ID 325551
Institutional Source Beutler Lab
Gene Symbol Gjd3
Ensembl Gene ENSMUSG00000047197
Gene Name gap junction protein, delta 3
Synonyms connexin 30.2, connexin-30.2, Gja11, Gjc1, cx30.2
MMRRC Submission 041685-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock # R4397 (G1)
Quality Score 105
Status Not validated
Chromosome 11
Chromosomal Location 98982180-98983016 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 98982421 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 199 (L199Q)
Ref Sequence ENSEMBL: ENSMUSP00000055246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062931]
AlphaFold Q91YD1
Predicted Effect probably damaging
Transcript: ENSMUST00000062931
AA Change: L199Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055246
Gene: ENSMUSG00000047197
AA Change: L199Q

DomainStartEndE-ValueType
CNX 43 76 1.85e-14 SMART
Connexin_CCC 146 212 3.14e-35 SMART
low complexity region 222 234 N/A INTRINSIC
low complexity region 251 268 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the large family of connexins that are required for the formation of gap junctions. Six connexin monomers form a hemichannel, or connexon, on the cell surface. This connexon can interact with a connexon from a neighboring cell, thus forming a channel linking the cytoplasm of the 2 cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit accelerated atrioventricular nodal conduction velocity in the heart but no significant alterations in excitability or fast network oscillations in the hippocampus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg4 T G X: 56,932,343 L2193V probably damaging Het
Agap2 G A 10: 127,090,483 A866T unknown Het
Aig1 A C 10: 13,652,982 S237A probably benign Het
Baz1b C T 5: 135,244,446 R1475W probably damaging Het
Bmp1 C T 14: 70,490,542 probably null Het
Crybg3 A G 16: 59,560,095 probably benign Het
Dnajc15 T C 14: 77,874,794 probably null Het
Fam135b T A 15: 71,448,676 H1334L probably benign Het
Fancg A T 4: 43,008,897 H113Q probably benign Het
Gfap G A 11: 102,896,984 A45V probably benign Het
Gm8979 A G 7: 106,082,923 noncoding transcript Het
H13 A G 2: 152,677,552 D65G probably damaging Het
Hcls1 T C 16: 36,937,300 V5A possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Homer3 G A 8: 70,290,143 probably null Het
Iqgap3 T C 3: 88,104,358 Y817H probably damaging Het
Iqsec2 C T X: 152,209,053 T562I probably damaging Het
Klb A G 5: 65,380,039 Y904C probably damaging Het
Kremen1 A T 11: 5,199,610 S354T probably benign Het
Lamc3 A G 2: 31,931,952 E1304G probably benign Het
Lrp4 T C 2: 91,511,670 V1876A probably benign Het
Magi3 T C 3: 104,219,714 T85A probably damaging Het
Map3k12 C T 15: 102,501,259 A694T probably benign Het
Mex3b T C 7: 82,869,823 S449P possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nars2 T C 7: 96,973,564 probably null Het
Nlrp1a T G 11: 71,097,204 M1046L probably benign Het
Nphs1 T G 7: 30,481,965 probably null Het
Nup133 G A 8: 123,944,301 T119M probably benign Het
Olfr770 G T 10: 129,133,581 N62K possibly damaging Het
Pcdhga9 A T 18: 37,738,641 I508F probably damaging Het
Phactr3 A G 2: 178,175,406 probably benign Het
Plcb3 T C 19: 6,965,825 K155E probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Prss38 T C 11: 59,373,028 Y286C probably damaging Het
Psg16 T C 7: 17,090,698 S45P possibly damaging Het
Ptpn21 G T 12: 98,688,248 P820Q probably damaging Het
Ptpn21 A G 12: 98,715,060 V105A probably damaging Het
Rnf7 A G 9: 96,478,410 M58T probably benign Het
Slc25a11 G A 11: 70,644,851 A287V probably benign Het
Slit2 G T 5: 48,220,081 probably null Het
Suco A G 1: 161,844,852 Y460H probably damaging Het
Tnxb C T 17: 34,678,662 Q804* probably null Het
Trpv6 A G 6: 41,625,238 I379T possibly damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Virma A G 4: 11,513,901 E585G possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Vmn2r88 A T 14: 51,417,978 D549V probably damaging Het
Other mutations in Gjd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02083:Gjd3 APN 11 98982761 missense probably damaging 1.00
R1642:Gjd3 UTSW 11 98982709 missense probably benign 0.01
R2267:Gjd3 UTSW 11 98982401 missense probably damaging 0.98
R5811:Gjd3 UTSW 11 98982400 missense possibly damaging 0.94
R7578:Gjd3 UTSW 11 98982475 missense probably damaging 0.99
R7657:Gjd3 UTSW 11 98982760 nonsense probably null
R8544:Gjd3 UTSW 11 98982662 nonsense probably null
R8704:Gjd3 UTSW 11 98982619 missense probably damaging 1.00
R8778:Gjd3 UTSW 11 98983016 start codon destroyed probably null 0.99
R8924:Gjd3 UTSW 11 98982499 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATATCCAGCCTCCGATCTCG -3'
(R):5'- ATCTACTCCATGCACCAGGC -3'

Sequencing Primer
(F):5'- TAGCCAGCGACGCTTTG -3'
(R):5'- TGCTACCTGCTGAGCGTG -3'
Posted On 2015-07-06