Incidental Mutation 'R4397:Gjd3'
ID 325551
Institutional Source Beutler Lab
Gene Symbol Gjd3
Ensembl Gene ENSMUSG00000047197
Gene Name gap junction protein, delta 3
Synonyms Gja11, connexin 30.2, cx30.2, connexin-30.2, Gjc1
MMRRC Submission 041685-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.325) question?
Stock # R4397 (G1)
Quality Score 105
Status Not validated
Chromosome 11
Chromosomal Location 98873006-98873842 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 98873247 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 199 (L199Q)
Ref Sequence ENSEMBL: ENSMUSP00000055246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062931]
AlphaFold Q91YD1
Predicted Effect probably damaging
Transcript: ENSMUST00000062931
AA Change: L199Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055246
Gene: ENSMUSG00000047197
AA Change: L199Q

DomainStartEndE-ValueType
CNX 43 76 1.85e-14 SMART
Connexin_CCC 146 212 3.14e-35 SMART
low complexity region 222 234 N/A INTRINSIC
low complexity region 251 268 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the large family of connexins that are required for the formation of gap junctions. Six connexin monomers form a hemichannel, or connexon, on the cell surface. This connexon can interact with a connexon from a neighboring cell, thus forming a channel linking the cytoplasm of the 2 cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit accelerated atrioventricular nodal conduction velocity in the heart but no significant alterations in excitability or fast network oscillations in the hippocampus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg4 T G X: 55,977,703 (GRCm39) L2193V probably damaging Het
Agap2 G A 10: 126,926,352 (GRCm39) A866T unknown Het
Aig1 A C 10: 13,528,726 (GRCm39) S237A probably benign Het
Baz1b C T 5: 135,273,300 (GRCm39) R1475W probably damaging Het
Bmp1 C T 14: 70,727,982 (GRCm39) probably null Het
Crybg3 A G 16: 59,380,458 (GRCm39) probably benign Het
Dnajc15 T C 14: 78,112,234 (GRCm39) probably null Het
Fam135b T A 15: 71,320,525 (GRCm39) H1334L probably benign Het
Fancg A T 4: 43,008,897 (GRCm39) H113Q probably benign Het
Gfap G A 11: 102,787,810 (GRCm39) A45V probably benign Het
Gvin-ps3 A G 7: 105,682,130 (GRCm39) noncoding transcript Het
H13 A G 2: 152,519,472 (GRCm39) D65G probably damaging Het
Hcls1 T C 16: 36,757,662 (GRCm39) V5A possibly damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Homer3 G A 8: 70,742,793 (GRCm39) probably null Het
Iqgap3 T C 3: 88,011,665 (GRCm39) Y817H probably damaging Het
Iqsec2 C T X: 150,992,049 (GRCm39) T562I probably damaging Het
Klb A G 5: 65,537,382 (GRCm39) Y904C probably damaging Het
Kremen1 A T 11: 5,149,610 (GRCm39) S354T probably benign Het
Lamc3 A G 2: 31,821,964 (GRCm39) E1304G probably benign Het
Lrp4 T C 2: 91,342,015 (GRCm39) V1876A probably benign Het
Magi3 T C 3: 104,127,030 (GRCm39) T85A probably damaging Het
Map3k12 C T 15: 102,409,694 (GRCm39) A694T probably benign Het
Mex3b T C 7: 82,519,031 (GRCm39) S449P possibly damaging Het
Naip6 C T 13: 100,437,108 (GRCm39) A472T probably benign Het
Nars2 T C 7: 96,622,771 (GRCm39) probably null Het
Nlrp1a T G 11: 70,988,030 (GRCm39) M1046L probably benign Het
Nphs1 T G 7: 30,181,390 (GRCm39) probably null Het
Nup133 G A 8: 124,671,040 (GRCm39) T119M probably benign Het
Or6c201 G T 10: 128,969,450 (GRCm39) N62K possibly damaging Het
Pcdhga9 A T 18: 37,871,694 (GRCm39) I508F probably damaging Het
Phactr3 A G 2: 177,817,199 (GRCm39) probably benign Het
Plcb3 T C 19: 6,943,193 (GRCm39) K155E probably damaging Het
Plxna2 C T 1: 194,431,625 (GRCm39) S538F probably damaging Het
Prss38 T C 11: 59,263,854 (GRCm39) Y286C probably damaging Het
Psg16 T C 7: 16,824,623 (GRCm39) S45P possibly damaging Het
Ptpn21 G T 12: 98,654,507 (GRCm39) P820Q probably damaging Het
Ptpn21 A G 12: 98,681,319 (GRCm39) V105A probably damaging Het
Rnf7 A G 9: 96,360,463 (GRCm39) M58T probably benign Het
Slc25a11 G A 11: 70,535,677 (GRCm39) A287V probably benign Het
Slit2 G T 5: 48,377,423 (GRCm39) probably null Het
Suco A G 1: 161,672,421 (GRCm39) Y460H probably damaging Het
Tnxb C T 17: 34,897,636 (GRCm39) Q804* probably null Het
Trpv6 A G 6: 41,602,172 (GRCm39) I379T possibly damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,139,706 (GRCm39) probably benign Het
Virma A G 4: 11,513,901 (GRCm39) E585G possibly damaging Het
Vmn2r79 A G 7: 86,651,099 (GRCm39) H166R possibly damaging Het
Vmn2r88 A T 14: 51,655,435 (GRCm39) D549V probably damaging Het
Other mutations in Gjd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01505:Gjd3 APN 11 102,691,552 (GRCm39) missense probably benign 0.16
IGL02083:Gjd3 APN 11 98,873,587 (GRCm39) missense probably damaging 1.00
IGL03164:Gjd3 APN 11 102,691,547 (GRCm39) missense possibly damaging 0.81
IGL03396:Gjd3 APN 11 102,691,353 (GRCm39) missense probably benign 0.00
PIT4812001:Gjd3 UTSW 11 102,691,807 (GRCm39) nonsense probably null
R0683:Gjd3 UTSW 11 102,691,237 (GRCm39) missense probably benign 0.00
R1642:Gjd3 UTSW 11 98,873,535 (GRCm39) missense probably benign 0.01
R1712:Gjd3 UTSW 11 102,691,706 (GRCm39) missense possibly damaging 0.96
R2267:Gjd3 UTSW 11 98,873,227 (GRCm39) missense probably damaging 0.98
R3853:Gjd3 UTSW 11 102,690,952 (GRCm39) missense probably benign 0.10
R4948:Gjd3 UTSW 11 102,691,247 (GRCm39) missense probably damaging 1.00
R5564:Gjd3 UTSW 11 102,691,029 (GRCm39) missense probably benign 0.04
R5811:Gjd3 UTSW 11 98,873,226 (GRCm39) missense possibly damaging 0.94
R6577:Gjd3 UTSW 11 102,691,130 (GRCm39) missense possibly damaging 0.69
R6939:Gjd3 UTSW 11 102,691,733 (GRCm39) missense probably damaging 0.98
R7263:Gjd3 UTSW 11 102,690,963 (GRCm39) missense possibly damaging 0.69
R7352:Gjd3 UTSW 11 102,691,278 (GRCm39) missense probably damaging 1.00
R7578:Gjd3 UTSW 11 98,873,301 (GRCm39) missense probably damaging 0.99
R7657:Gjd3 UTSW 11 98,873,586 (GRCm39) nonsense probably null
R7900:Gjd3 UTSW 11 102,690,920 (GRCm39) missense probably benign 0.00
R8187:Gjd3 UTSW 11 102,691,381 (GRCm39) nonsense probably null
R8544:Gjd3 UTSW 11 98,873,488 (GRCm39) nonsense probably null
R8704:Gjd3 UTSW 11 98,873,445 (GRCm39) missense probably damaging 1.00
R8778:Gjd3 UTSW 11 98,873,842 (GRCm39) start codon destroyed probably null 0.99
R8883:Gjd3 UTSW 11 102,691,769 (GRCm39) missense probably damaging 0.98
R8924:Gjd3 UTSW 11 98,873,325 (GRCm39) missense probably damaging 1.00
Z1176:Gjd3 UTSW 11 102,690,834 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TGATATCCAGCCTCCGATCTCG -3'
(R):5'- ATCTACTCCATGCACCAGGC -3'

Sequencing Primer
(F):5'- TAGCCAGCGACGCTTTG -3'
(R):5'- TGCTACCTGCTGAGCGTG -3'
Posted On 2015-07-06