Mutagenetix > Incidental Mutation

Incidental Mutation 'R4397:Ptpn21'

325555

Institutional Source

Beutler Lab

Gene Symbol

Ptpn21

Ensembl Gene

ENSMUSG00000021009

Gene Name

protein tyrosine phosphatase, non-receptor type 21

Synonyms

PTPD1, PTPRL10

MMRRC Submission

041685-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.162) question?

Stock #

R4397 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

98676741-98737405 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 98688248 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Glutamine at position 820 (P820Q)

Ref Sequence

ENSEMBL: ENSMUSP00000152639 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085116] [ENSMUST00000170188] [ENSMUST00000221148] [ENSMUST00000221535] [ENSMUST00000221932]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000085116
AA Change: P820Q

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000082197
Gene: ENSMUSG00000021009
AA Change: P820Q

Domain	Start	End	E-Value	Type
B41	19	222	5.04e-69	SMART
FERM_C	226	312	4.66e-26	SMART
low complexity region	332	343	N/A	INTRINSIC
low complexity region	563	574	N/A	INTRINSIC
low complexity region	710	724	N/A	INTRINSIC
PTPc	897	1171	7.31e-111	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000170188
AA Change: P820Q

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000126975
Gene: ENSMUSG00000021009
AA Change: P820Q

Domain	Start	End	E-Value	Type
B41	19	222	5.04e-69	SMART
FERM_C	226	312	4.66e-26	SMART
low complexity region	332	343	N/A	INTRINSIC
low complexity region	563	574	N/A	INTRINSIC
low complexity region	710	724	N/A	INTRINSIC
PTPc	897	1171	7.31e-111	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000221148

Predicted Effect

probably benign
Transcript: ENSMUST00000221535

Predicted Effect

probably damaging
Transcript: ENSMUST00000221932
AA Change: P820Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223321

Meta Mutation Damage Score

0.1096

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

96% (55/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an N-terminal domain, similar to cytoskeletal- associated proteins including band 4.1, ezrin, merlin, and radixin. This PTP was shown to specially interact with BMX/ETK, a member of Tec tyrosine kinase family characterized by a multimodular structures including PH, SH3, and SH2 domains. The interaction of this PTP with BMX kinase was found to increase the activation of STAT3, but not STAT2 kinase. Studies of the similar gene in mice suggested the possible roles of this PTP in liver regeneration and spermatogenesis. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrg4	T	G	X: 56,932,343	L2193V	probably damaging	Het
Agap2	G	A	10: 127,090,483	A866T	unknown	Het
Aig1	A	C	10: 13,652,982	S237A	probably benign	Het
Baz1b	C	T	5: 135,244,446	R1475W	probably damaging	Het
Bmp1	C	T	14: 70,490,542		probably null	Het
Crybg3	A	G	16: 59,560,095		probably benign	Het
Dnajc15	T	C	14: 77,874,794		probably null	Het
Fam135b	T	A	15: 71,448,676	H1334L	probably benign	Het
Fancg	A	T	4: 43,008,897	H113Q	probably benign	Het
Gfap	G	A	11: 102,896,984	A45V	probably benign	Het
Gjd3	A	T	11: 98,982,421	L199Q	probably damaging	Het
Gm8979	A	G	7: 106,082,923		noncoding transcript	Het
H13	A	G	2: 152,677,552	D65G	probably damaging	Het
Hcls1	T	C	16: 36,937,300	V5A	possibly damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Homer3	G	A	8: 70,290,143		probably null	Het
Iqgap3	T	C	3: 88,104,358	Y817H	probably damaging	Het
Iqsec2	C	T	X: 152,209,053	T562I	probably damaging	Het
Klb	A	G	5: 65,380,039	Y904C	probably damaging	Het
Kremen1	A	T	11: 5,199,610	S354T	probably benign	Het
Lamc3	A	G	2: 31,931,952	E1304G	probably benign	Het
Lrp4	T	C	2: 91,511,670	V1876A	probably benign	Het
Magi3	T	C	3: 104,219,714	T85A	probably damaging	Het
Map3k12	C	T	15: 102,501,259	A694T	probably benign	Het
Mex3b	T	C	7: 82,869,823	S449P	possibly damaging	Het
Naip6	C	T	13: 100,300,600	A472T	probably benign	Het
Nars2	T	C	7: 96,973,564		probably null	Het
Nlrp1a	T	G	11: 71,097,204	M1046L	probably benign	Het
Nphs1	T	G	7: 30,481,965		probably null	Het
Nup133	G	A	8: 123,944,301	T119M	probably benign	Het
Olfr770	G	T	10: 129,133,581	N62K	possibly damaging	Het
Pcdhga9	A	T	18: 37,738,641	I508F	probably damaging	Het
Phactr3	A	G	2: 178,175,406		probably benign	Het
Plcb3	T	C	19: 6,965,825	K155E	probably damaging	Het
Plxna2	C	T	1: 194,749,317	S538F	probably damaging	Het
Prss38	T	C	11: 59,373,028	Y286C	probably damaging	Het
Psg16	T	C	7: 17,090,698	S45P	possibly damaging	Het
Rnf7	A	G	9: 96,478,410	M58T	probably benign	Het
Slc25a11	G	A	11: 70,644,851	A287V	probably benign	Het
Slit2	G	T	5: 48,220,081		probably null	Het
Suco	A	G	1: 161,844,852	Y460H	probably damaging	Het
Tnxb	C	T	17: 34,678,662	Q804*	probably null	Het
Trpv6	A	G	6: 41,625,238	I379T	possibly damaging	Het
Ugt1a1	CAGAGAGAGAGAGA	CAGAGAGAGAGA	1: 88,211,984		probably benign	Het
Virma	A	G	4: 11,513,901	E585G	possibly damaging	Het
Vmn2r79	A	G	7: 87,001,891	H166R	possibly damaging	Het
Vmn2r88	A	T	14: 51,417,978	D549V	probably damaging	Het

Other mutations in Ptpn21

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Ptpn21	APN	12	98680468	missense	probably damaging	1.00
IGL00576:Ptpn21	APN	12	98733601	missense	probably damaging	1.00
IGL00577:Ptpn21	APN	12	98733601	missense	probably damaging	1.00
IGL00580:Ptpn21	APN	12	98733601	missense	probably damaging	1.00
IGL00583:Ptpn21	APN	12	98733601	missense	probably damaging	1.00
IGL00773:Ptpn21	APN	12	98688313	missense	probably benign	0.00
IGL00780:Ptpn21	APN	12	98680371	missense	probably damaging	1.00
IGL01516:Ptpn21	APN	12	98715189	missense	probably damaging	1.00
IGL01616:Ptpn21	APN	12	98680013	missense	probably damaging	1.00
IGL01939:Ptpn21	APN	12	98689161	missense	probably damaging	0.96
IGL02237:Ptpn21	APN	12	98705092	critical splice donor site	probably null
IGL02512:Ptpn21	APN	12	98679392	missense	probably benign	0.00
IGL02852:Ptpn21	APN	12	98715195	critical splice acceptor site	probably null
IGL02894:Ptpn21	APN	12	98689632	splice site	probably benign
IGL03024:Ptpn21	APN	12	98680056	missense	probably benign
IGL03220:Ptpn21	APN	12	98678623	missense	probably damaging	1.00
R0144:Ptpn21	UTSW	12	98688609	missense	probably benign	0.01
R0472:Ptpn21	UTSW	12	98704240	splice site	probably benign
R0675:Ptpn21	UTSW	12	98688216	missense	probably benign	0.16
R0771:Ptpn21	UTSW	12	98689080	missense	probably damaging	1.00
R1434:Ptpn21	UTSW	12	98688590	missense	probably damaging	1.00
R1470:Ptpn21	UTSW	12	98688476	missense	probably benign
R1470:Ptpn21	UTSW	12	98688476	missense	probably benign
R1837:Ptpn21	UTSW	12	98733626	missense	probably damaging	0.99
R1897:Ptpn21	UTSW	12	98680405	splice site	probably null
R2048:Ptpn21	UTSW	12	98689526	missense	possibly damaging	0.94
R2376:Ptpn21	UTSW	12	98688314	missense	possibly damaging	0.62
R3709:Ptpn21	UTSW	12	98688541	missense	probably benign
R4197:Ptpn21	UTSW	12	98680138	missense	probably damaging	1.00
R4283:Ptpn21	UTSW	12	98733475	missense	probably damaging	0.99
R4368:Ptpn21	UTSW	12	98678593	missense	probably damaging	1.00
R4397:Ptpn21	UTSW	12	98715060	missense	probably damaging	0.98
R4703:Ptpn21	UTSW	12	98679392	missense	probably benign	0.00
R4737:Ptpn21	UTSW	12	98708844	missense	probably benign	0.03
R4829:Ptpn21	UTSW	12	98689296	missense	probably damaging	1.00
R4926:Ptpn21	UTSW	12	98715195	critical splice acceptor site	probably null
R4974:Ptpn21	UTSW	12	98680103	missense	probably damaging	1.00
R5022:Ptpn21	UTSW	12	98679407	missense	probably damaging	1.00
R5057:Ptpn21	UTSW	12	98679407	missense	probably damaging	1.00
R5395:Ptpn21	UTSW	12	98715117	missense	probably damaging	1.00
R5608:Ptpn21	UTSW	12	98688777	missense	probably benign	0.00
R5741:Ptpn21	UTSW	12	98679289	missense	probably damaging	1.00
R5785:Ptpn21	UTSW	12	98682550	missense	probably damaging	0.99
R5959:Ptpn21	UTSW	12	98708889	splice site	probably null
R5968:Ptpn21	UTSW	12	98710890	missense	probably damaging	1.00
R5984:Ptpn21	UTSW	12	98689076	missense	probably damaging	1.00
R6005:Ptpn21	UTSW	12	98678552	makesense	probably null
R6181:Ptpn21	UTSW	12	98699999	missense	probably damaging	0.99
R6226:Ptpn21	UTSW	12	98680116	missense	probably benign	0.24
R6226:Ptpn21	UTSW	12	98715172	missense	probably damaging	1.00
R6317:Ptpn21	UTSW	12	98689262	missense	probably damaging	1.00
R6370:Ptpn21	UTSW	12	98689034	missense	possibly damaging	0.86
R6485:Ptpn21	UTSW	12	98698872	nonsense	probably null
R6894:Ptpn21	UTSW	12	98715181	missense	probably damaging	1.00
R7122:Ptpn21	UTSW	12	98688912	missense	probably damaging	0.99
R7232:Ptpn21	UTSW	12	98688737	missense	probably benign	0.17
R7289:Ptpn21	UTSW	12	98704191	missense	probably benign	0.35
R7327:Ptpn21	UTSW	12	98680101	missense	probably damaging	1.00
R7474:Ptpn21	UTSW	12	98737363	critical splice donor site	probably null
R7748:Ptpn21	UTSW	12	98688772	missense	probably benign	0.01
R7816:Ptpn21	UTSW	12	98682532	missense	probably damaging	1.00
R7867:Ptpn21	UTSW	12	98705176	missense	probably damaging	1.00
R7878:Ptpn21	UTSW	12	98715128	missense	probably damaging	1.00
R7911:Ptpn21	UTSW	12	98688842	missense	probably damaging	0.99
R8100:Ptpn21	UTSW	12	98682622	missense	possibly damaging	0.61
R8199:Ptpn21	UTSW	12	98678582	missense	possibly damaging	0.92
R8272:Ptpn21	UTSW	12	98688530	missense	probably benign
R8481:Ptpn21	UTSW	12	98688894	missense	probably benign	0.03
R8535:Ptpn21	UTSW	12	98680026	missense	probably damaging	0.98
R8775:Ptpn21	UTSW	12	98682742	critical splice acceptor site	probably null
R8775-TAIL:Ptpn21	UTSW	12	98682742	critical splice acceptor site	probably null
R8929:Ptpn21	UTSW	12	98689137	missense	probably damaging	0.99
R8969:Ptpn21	UTSW	12	98689025	missense	probably benign	0.39
R9189:Ptpn21	UTSW	12	98689002	missense	probably damaging	1.00
R9781:Ptpn21	UTSW	12	98688911	missense	probably damaging	1.00
Z1177:Ptpn21	UTSW	12	98688458	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- AGTTTCCACATAAACTCGTACACG -3'
(R):5'- TTTTGAGCCCAAGCCCCATG -3'

Sequencing Primer
(F):5'- CAGAACTCAGAGCTGGGGC -3'
(R):5'- CCATGTCACAGAGCCTGAG -3'

Posted On

2015-07-06