Mutagenetix > Incidental Mutation

Incidental Mutation 'R4397:Bmp1'

325559

Institutional Source

Beutler Lab

Gene Symbol

Bmp1

Ensembl Gene

ENSMUSG00000022098

Gene Name

bone morphogenetic protein 1

Synonyms

MMRRC Submission

041685-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4397 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70474558-70520234 bp(-) (GRCm38)

Type of Mutation

splice site (5 bp from exon)

DNA Base Change (assembly)

C to T at 70490542 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000022693 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022693] [ENSMUST00000022693] [ENSMUST00000022693] [ENSMUST00000226246] [ENSMUST00000226906] [ENSMUST00000227944]

AlphaFold

P98063

Predicted Effect

probably null
Transcript: ENSMUST00000022693

SMART Domains

Protein: ENSMUSP00000022693
Gene: ENSMUSG00000022098

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
ZnMc	131	273	1.32e-54	SMART
CUB	327	439	4.35e-43	SMART
CUB	440	552	7.86e-50	SMART
EGF_CA	552	593	5.03e-11	SMART
CUB	596	708	1.13e-50	SMART
EGF_CA	708	748	4.81e-8	SMART
CUB	752	864	3.99e-51	SMART
CUB	865	981	7.35e-41	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000022693

SMART Domains

Protein: ENSMUSP00000022693
Gene: ENSMUSG00000022098

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
ZnMc	131	273	1.32e-54	SMART
CUB	327	439	4.35e-43	SMART
CUB	440	552	7.86e-50	SMART
EGF_CA	552	593	5.03e-11	SMART
CUB	596	708	1.13e-50	SMART
EGF_CA	708	748	4.81e-8	SMART
CUB	752	864	3.99e-51	SMART
CUB	865	981	7.35e-41	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000022693

SMART Domains

Protein: ENSMUSP00000022693
Gene: ENSMUSG00000022098

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
ZnMc	131	273	1.32e-54	SMART
CUB	327	439	4.35e-43	SMART
CUB	440	552	7.86e-50	SMART
EGF_CA	552	593	5.03e-11	SMART
CUB	596	708	1.13e-50	SMART
EGF_CA	708	748	4.81e-8	SMART
CUB	752	864	3.99e-51	SMART
CUB	865	981	7.35e-41	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000226246

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226601

Predicted Effect

probably benign
Transcript: ENSMUST00000226906

Predicted Effect

probably benign
Transcript: ENSMUST00000227944

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228501

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

96% (55/57)

MGI Phenotype

FUNCTION: This gene encodes a metalloproteinase that plays an essential role in the formation of the extracellular matrix and is also able to induce ectopic bone formation. Unlike other bone morphogenetic proteins, the protein encoded by this gene is not closely related to transforming growth factor-beta. This protein plays in role several developmental processes. In humans, mutations in this gene are associated with osteogenesis imperfecta and with increased bone mineral density and multiple recurrent fractures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous targeted mutant embryos have reduced ossification of the skull, persistent herniation of the gut, abnormal collagen fibrils in the amnion, and die at birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrg4	T	G	X: 56,932,343	L2193V	probably damaging	Het
Agap2	G	A	10: 127,090,483	A866T	unknown	Het
Aig1	A	C	10: 13,652,982	S237A	probably benign	Het
Baz1b	C	T	5: 135,244,446	R1475W	probably damaging	Het
Crybg3	A	G	16: 59,560,095		probably benign	Het
Dnajc15	T	C	14: 77,874,794		probably null	Het
Fam135b	T	A	15: 71,448,676	H1334L	probably benign	Het
Fancg	A	T	4: 43,008,897	H113Q	probably benign	Het
Gfap	G	A	11: 102,896,984	A45V	probably benign	Het
Gjd3	A	T	11: 98,982,421	L199Q	probably damaging	Het
Gm8979	A	G	7: 106,082,923		noncoding transcript	Het
H13	A	G	2: 152,677,552	D65G	probably damaging	Het
Hcls1	T	C	16: 36,937,300	V5A	possibly damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Homer3	G	A	8: 70,290,143		probably null	Het
Iqgap3	T	C	3: 88,104,358	Y817H	probably damaging	Het
Iqsec2	C	T	X: 152,209,053	T562I	probably damaging	Het
Klb	A	G	5: 65,380,039	Y904C	probably damaging	Het
Kremen1	A	T	11: 5,199,610	S354T	probably benign	Het
Lamc3	A	G	2: 31,931,952	E1304G	probably benign	Het
Lrp4	T	C	2: 91,511,670	V1876A	probably benign	Het
Magi3	T	C	3: 104,219,714	T85A	probably damaging	Het
Map3k12	C	T	15: 102,501,259	A694T	probably benign	Het
Mex3b	T	C	7: 82,869,823	S449P	possibly damaging	Het
Naip6	C	T	13: 100,300,600	A472T	probably benign	Het
Nars2	T	C	7: 96,973,564		probably null	Het
Nlrp1a	T	G	11: 71,097,204	M1046L	probably benign	Het
Nphs1	T	G	7: 30,481,965		probably null	Het
Nup133	G	A	8: 123,944,301	T119M	probably benign	Het
Olfr770	G	T	10: 129,133,581	N62K	possibly damaging	Het
Pcdhga9	A	T	18: 37,738,641	I508F	probably damaging	Het
Phactr3	A	G	2: 178,175,406		probably benign	Het
Plcb3	T	C	19: 6,965,825	K155E	probably damaging	Het
Plxna2	C	T	1: 194,749,317	S538F	probably damaging	Het
Prss38	T	C	11: 59,373,028	Y286C	probably damaging	Het
Psg16	T	C	7: 17,090,698	S45P	possibly damaging	Het
Ptpn21	G	T	12: 98,688,248	P820Q	probably damaging	Het
Ptpn21	A	G	12: 98,715,060	V105A	probably damaging	Het
Rnf7	A	G	9: 96,478,410	M58T	probably benign	Het
Slc25a11	G	A	11: 70,644,851	A287V	probably benign	Het
Slit2	G	T	5: 48,220,081		probably null	Het
Suco	A	G	1: 161,844,852	Y460H	probably damaging	Het
Tnxb	C	T	17: 34,678,662	Q804*	probably null	Het
Trpv6	A	G	6: 41,625,238	I379T	possibly damaging	Het
Ugt1a1	CAGAGAGAGAGAGA	CAGAGAGAGAGA	1: 88,211,984		probably benign	Het
Virma	A	G	4: 11,513,901	E585G	possibly damaging	Het
Vmn2r79	A	G	7: 87,001,891	H166R	possibly damaging	Het
Vmn2r88	A	T	14: 51,417,978	D549V	probably damaging	Het

Other mutations in Bmp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01637:Bmp1	APN	14	70492461	missense	probably damaging	1.00
IGL02065:Bmp1	APN	14	70486220	missense	probably damaging	0.97
IGL02065:Bmp1	APN	14	70490107	missense	probably damaging	0.99
IGL02349:Bmp1	APN	14	70507549	missense	possibly damaging	0.61
IGL02486:Bmp1	APN	14	70504776	missense	possibly damaging	0.48
PIT4519001:Bmp1	UTSW	14	70490029	missense	possibly damaging	0.65
R0394:Bmp1	UTSW	14	70490034	missense	probably damaging	0.99
R1371:Bmp1	UTSW	14	70492466	missense	probably damaging	1.00
R1604:Bmp1	UTSW	14	70508004	missense	possibly damaging	0.66
R1732:Bmp1	UTSW	14	70486265	missense	possibly damaging	0.67
R1834:Bmp1	UTSW	14	70508831	missense	possibly damaging	0.73
R2008:Bmp1	UTSW	14	70492466	missense	probably damaging	1.00
R2197:Bmp1	UTSW	14	70486272	missense	possibly damaging	0.83
R3157:Bmp1	UTSW	14	70492107	missense	possibly damaging	0.63
R4609:Bmp1	UTSW	14	70477966	missense	probably benign	0.00
R4613:Bmp1	UTSW	14	70508523	missense	probably damaging	1.00
R4675:Bmp1	UTSW	14	70492844	missense	probably damaging	0.99
R4796:Bmp1	UTSW	14	70492073	splice site	probably null
R4884:Bmp1	UTSW	14	70475215	missense	probably benign	0.01
R4905:Bmp1	UTSW	14	70491362	missense	probably benign	0.06
R5088:Bmp1	UTSW	14	70486219	missense	possibly damaging	0.84
R5225:Bmp1	UTSW	14	70480165	missense	probably damaging	0.97
R5271:Bmp1	UTSW	14	70508128	missense	probably benign	0.34
R5625:Bmp1	UTSW	14	70486166	missense	probably benign	0.19
R5653:Bmp1	UTSW	14	70490094	missense	probably benign	0.00
R6155:Bmp1	UTSW	14	70508007	missense	probably damaging	1.00
R6295:Bmp1	UTSW	14	70491383	missense	possibly damaging	0.88
R6618:Bmp1	UTSW	14	70491368	missense	probably damaging	1.00
R6649:Bmp1	UTSW	14	70490618	missense	probably damaging	1.00
R6653:Bmp1	UTSW	14	70490618	missense	probably damaging	1.00
R6951:Bmp1	UTSW	14	70508858	missense	probably benign	0.26
R6983:Bmp1	UTSW	14	70508207	missense	probably damaging	0.96
R7207:Bmp1	UTSW	14	70479560	missense	possibly damaging	0.56
R7500:Bmp1	UTSW	14	70490122	missense	probably benign	0.44
R7716:Bmp1	UTSW	14	70477922	nonsense	probably null
R7749:Bmp1	UTSW	14	70492844	missense	probably damaging	1.00
R7763:Bmp1	UTSW	14	70492084	missense	probably damaging	1.00
R7834:Bmp1	UTSW	14	70508565	missense	probably damaging	1.00
R8232:Bmp1	UTSW	14	70519889	missense	probably damaging	0.97
R8490:Bmp1	UTSW	14	70490133	missense	possibly damaging	0.94
R8827:Bmp1	UTSW	14	70490642	missense	probably damaging	1.00
R8945:Bmp1	UTSW	14	70490190	missense	probably damaging	1.00
R9178:Bmp1	UTSW	14	70490173	missense	possibly damaging	0.78
R9228:Bmp1	UTSW	14	70519898	missense	probably benign
R9621:Bmp1	UTSW	14	70477866	missense	probably benign	0.29
R9652:Bmp1	UTSW	14	70477920	missense	probably damaging	1.00
X0028:Bmp1	UTSW	14	70508537	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAATGTCCACCCTCATCTGCAG -3'
(R):5'- AACCTTGAGCCCCTAGAGTG -3'

Sequencing Primer
(F):5'- AGAGCCTCCTTTGCGACC -3'
(R):5'- ACTCCTGGTGGGTGATGCC -3'

Posted On

2015-07-06