Incidental Mutation 'R4397:Pcdhga9'
ID 325566
Institutional Source Beutler Lab
Gene Symbol Pcdhga9
Ensembl Gene ENSMUSG00000102440
Gene Name protocadherin gamma subfamily A, 9
Synonyms
MMRRC Submission 041685-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.120) question?
Stock # R4397 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 37869989-37974916 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 37871694 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 508 (I508F)
Ref Sequence ENSEMBL: ENSMUSP00000089555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003599] [ENSMUST00000066149] [ENSMUST00000073447] [ENSMUST00000091935] [ENSMUST00000115661] [ENSMUST00000192511] [ENSMUST00000194544] [ENSMUST00000194190] [ENSMUST00000194418] [ENSMUST00000192931] [ENSMUST00000195363] [ENSMUST00000192535] [ENSMUST00000193414] [ENSMUST00000193869] [ENSMUST00000195112] [ENSMUST00000195823]
AlphaFold Q91XX9
Predicted Effect probably benign
Transcript: ENSMUST00000003599
SMART Domains Protein: ENSMUSP00000003599
Gene: ENSMUSG00000103088

DomainStartEndE-ValueType
CA 47 131 8.06e-6 SMART
CA 155 240 2.29e-19 SMART
CA 264 345 3.36e-26 SMART
CA 369 450 4.94e-24 SMART
CA 474 560 7.6e-25 SMART
CA 591 672 9.18e-10 SMART
Pfam:Cadherin_C_2 687 768 3.5e-20 PFAM
Pfam:Cadherin_tail 807 930 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066149
SMART Domains Protein: ENSMUSP00000067728
Gene: ENSMUSG00000103897

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CA 31 131 4.84e-2 SMART
CA 155 240 1.48e-22 SMART
CA 264 345 1.14e-23 SMART
CA 369 450 9.44e-21 SMART
CA 474 560 1.03e-26 SMART
CA 591 669 3.64e-13 SMART
Pfam:Cadherin_C_2 688 772 3e-25 PFAM
Pfam:Cadherin_tail 809 932 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073447
SMART Domains Protein: ENSMUSP00000073150
Gene: ENSMUSG00000104346

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 42 128 2.15e-2 SMART
CA 152 237 4.8e-13 SMART
CA 261 342 9.36e-25 SMART
CA 366 447 6.62e-25 SMART
CA 471 557 6.72e-26 SMART
CA 588 666 2.15e-15 SMART
Pfam:Cadherin_C_2 685 768 4.8e-24 PFAM
Pfam:Cadherin_tail 805 928 8.1e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000091935
AA Change: I508F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089555
Gene: ENSMUSG00000102440
AA Change: I508F

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CA 32 132 8.37e-3 SMART
CA 156 241 5.51e-22 SMART
CA 265 346 8.27e-26 SMART
CA 370 451 1.4e-23 SMART
CA 475 561 2.97e-27 SMART
CA 592 670 1.18e-12 SMART
Pfam:Cadherin_C_2 688 772 3.9e-24 PFAM
Pfam:Cadherin_tail 809 932 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192511
SMART Domains Protein: ENSMUSP00000141704
Gene: ENSMUSG00000103472

DomainStartEndE-ValueType
CA 47 133 1.57e-2 SMART
CA 157 242 3.24e-19 SMART
CA 266 347 3.21e-23 SMART
CA 371 452 9.08e-23 SMART
CA 476 562 1.32e-24 SMART
CA 593 671 3.5e-15 SMART
transmembrane domain 694 716 N/A INTRINSIC
low complexity region 916 935 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193006
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194190
SMART Domains Protein: ENSMUSP00000142062
Gene: ENSMUSG00000103144

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 31 131 3.16e-2 SMART
CA 155 240 5.39e-16 SMART
CA 264 345 6.72e-26 SMART
CA 369 450 1.32e-24 SMART
CA 474 560 4.17e-22 SMART
CA 591 669 4.48e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194418
SMART Domains Protein: ENSMUSP00000142140
Gene: ENSMUSG00000103677

DomainStartEndE-ValueType
CA 44 130 1.64e-2 SMART
CA 154 239 3.93e-18 SMART
CA 263 344 5.22e-23 SMART
CA 368 449 5.02e-25 SMART
CA 473 559 2.07e-26 SMART
CA 590 668 6.84e-18 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000192931
SMART Domains Protein: ENSMUSP00000141348
Gene: ENSMUSG00000103037

DomainStartEndE-ValueType
CA 36 119 8e-3 SMART
CA 143 228 1.34e-20 SMART
CA 252 333 1.52e-24 SMART
CA 357 438 9.22e-24 SMART
CA 462 548 1.24e-24 SMART
CA 579 660 1.3e-9 SMART
transmembrane domain 679 701 N/A INTRINSIC
low complexity region 899 918 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195363
SMART Domains Protein: ENSMUSP00000142227
Gene: ENSMUSG00000103585

DomainStartEndE-ValueType
low complexity region 17 25 N/A INTRINSIC
CA 56 131 1.47e-2 SMART
CA 155 240 1.23e-19 SMART
CA 264 343 5.54e-27 SMART
CA 367 448 5.09e-26 SMART
CA 472 558 1.98e-23 SMART
CA 589 670 1.3e-9 SMART
transmembrane domain 689 711 N/A INTRINSIC
low complexity region 893 912 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192535
SMART Domains Protein: ENSMUSP00000142010
Gene: ENSMUSG00000103749

DomainStartEndE-ValueType
low complexity region 17 25 N/A INTRINSIC
CA 56 131 8e-3 SMART
CA 155 240 2.49e-20 SMART
CA 264 341 4.97e-29 SMART
CA 365 446 1.09e-25 SMART
CA 470 556 1.75e-24 SMART
CA 587 668 9.18e-10 SMART
transmembrane domain 687 709 N/A INTRINSIC
low complexity region 907 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193414
SMART Domains Protein: ENSMUSP00000141893
Gene: ENSMUSG00000103567

DomainStartEndE-ValueType
CA 45 131 2.45e-1 SMART
CA 155 240 1.05e-18 SMART
CA 264 345 6.52e-24 SMART
CA 369 450 5.99e-23 SMART
CA 474 560 6.99e-24 SMART
CA 591 669 5.31e-15 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 913 932 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193869
SMART Domains Protein: ENSMUSP00000141482
Gene: ENSMUSG00000103332

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 45 131 1.64e-2 SMART
CA 155 240 6.42e-23 SMART
CA 264 345 1.76e-20 SMART
CA 369 450 2.27e-23 SMART
CA 474 560 1.5e-23 SMART
CA 591 669 1.17e-16 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195112
SMART Domains Protein: ENSMUSP00000141449
Gene: ENSMUSG00000102748

DomainStartEndE-ValueType
CA 24 130 8.18e-3 SMART
CA 154 239 1.39e-18 SMART
CA 263 344 7.91e-23 SMART
CA 368 449 2.27e-23 SMART
CA 473 559 1.24e-24 SMART
CA 590 671 1.3e-9 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 909 928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195823
SMART Domains Protein: ENSMUSP00000141803
Gene: ENSMUSG00000103793

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
CA 45 131 2.41e-2 SMART
CA 155 240 5.77e-16 SMART
CA 264 345 1.1e-21 SMART
CA 369 450 2.75e-22 SMART
low complexity region 453 462 N/A INTRINSIC
CA 474 560 9.22e-24 SMART
CA 591 669 2.4e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 913 932 N/A INTRINSIC
Meta Mutation Damage Score 0.3476 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg4 T G X: 55,977,703 (GRCm39) L2193V probably damaging Het
Agap2 G A 10: 126,926,352 (GRCm39) A866T unknown Het
Aig1 A C 10: 13,528,726 (GRCm39) S237A probably benign Het
Baz1b C T 5: 135,273,300 (GRCm39) R1475W probably damaging Het
Bmp1 C T 14: 70,727,982 (GRCm39) probably null Het
Crybg3 A G 16: 59,380,458 (GRCm39) probably benign Het
Dnajc15 T C 14: 78,112,234 (GRCm39) probably null Het
Fam135b T A 15: 71,320,525 (GRCm39) H1334L probably benign Het
Fancg A T 4: 43,008,897 (GRCm39) H113Q probably benign Het
Gfap G A 11: 102,787,810 (GRCm39) A45V probably benign Het
Gjd3 A T 11: 98,873,247 (GRCm39) L199Q probably damaging Het
Gvin-ps3 A G 7: 105,682,130 (GRCm39) noncoding transcript Het
H13 A G 2: 152,519,472 (GRCm39) D65G probably damaging Het
Hcls1 T C 16: 36,757,662 (GRCm39) V5A possibly damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Homer3 G A 8: 70,742,793 (GRCm39) probably null Het
Iqgap3 T C 3: 88,011,665 (GRCm39) Y817H probably damaging Het
Iqsec2 C T X: 150,992,049 (GRCm39) T562I probably damaging Het
Klb A G 5: 65,537,382 (GRCm39) Y904C probably damaging Het
Kremen1 A T 11: 5,149,610 (GRCm39) S354T probably benign Het
Lamc3 A G 2: 31,821,964 (GRCm39) E1304G probably benign Het
Lrp4 T C 2: 91,342,015 (GRCm39) V1876A probably benign Het
Magi3 T C 3: 104,127,030 (GRCm39) T85A probably damaging Het
Map3k12 C T 15: 102,409,694 (GRCm39) A694T probably benign Het
Mex3b T C 7: 82,519,031 (GRCm39) S449P possibly damaging Het
Naip6 C T 13: 100,437,108 (GRCm39) A472T probably benign Het
Nars2 T C 7: 96,622,771 (GRCm39) probably null Het
Nlrp1a T G 11: 70,988,030 (GRCm39) M1046L probably benign Het
Nphs1 T G 7: 30,181,390 (GRCm39) probably null Het
Nup133 G A 8: 124,671,040 (GRCm39) T119M probably benign Het
Or6c201 G T 10: 128,969,450 (GRCm39) N62K possibly damaging Het
Phactr3 A G 2: 177,817,199 (GRCm39) probably benign Het
Plcb3 T C 19: 6,943,193 (GRCm39) K155E probably damaging Het
Plxna2 C T 1: 194,431,625 (GRCm39) S538F probably damaging Het
Prss38 T C 11: 59,263,854 (GRCm39) Y286C probably damaging Het
Psg16 T C 7: 16,824,623 (GRCm39) S45P possibly damaging Het
Ptpn21 G T 12: 98,654,507 (GRCm39) P820Q probably damaging Het
Ptpn21 A G 12: 98,681,319 (GRCm39) V105A probably damaging Het
Rnf7 A G 9: 96,360,463 (GRCm39) M58T probably benign Het
Slc25a11 G A 11: 70,535,677 (GRCm39) A287V probably benign Het
Slit2 G T 5: 48,377,423 (GRCm39) probably null Het
Suco A G 1: 161,672,421 (GRCm39) Y460H probably damaging Het
Tnxb C T 17: 34,897,636 (GRCm39) Q804* probably null Het
Trpv6 A G 6: 41,602,172 (GRCm39) I379T possibly damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,139,706 (GRCm39) probably benign Het
Virma A G 4: 11,513,901 (GRCm39) E585G possibly damaging Het
Vmn2r79 A G 7: 86,651,099 (GRCm39) H166R possibly damaging Het
Vmn2r88 A T 14: 51,655,435 (GRCm39) D549V probably damaging Het
Other mutations in Pcdhga9
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4468001:Pcdhga9 UTSW 18 37,872,527 (GRCm39) nonsense probably null
R2870:Pcdhga9 UTSW 18 37,870,524 (GRCm39) missense possibly damaging 0.93
R2870:Pcdhga9 UTSW 18 37,870,524 (GRCm39) missense possibly damaging 0.93
R2871:Pcdhga9 UTSW 18 37,870,524 (GRCm39) missense possibly damaging 0.93
R2871:Pcdhga9 UTSW 18 37,870,524 (GRCm39) missense possibly damaging 0.93
R2872:Pcdhga9 UTSW 18 37,870,524 (GRCm39) missense possibly damaging 0.93
R2872:Pcdhga9 UTSW 18 37,870,524 (GRCm39) missense possibly damaging 0.93
R2873:Pcdhga9 UTSW 18 37,870,524 (GRCm39) missense possibly damaging 0.93
R3727:Pcdhga9 UTSW 18 37,871,995 (GRCm39) missense probably benign 0.03
R3918:Pcdhga9 UTSW 18 37,871,995 (GRCm39) missense probably benign 0.03
R3939:Pcdhga9 UTSW 18 37,871,995 (GRCm39) missense probably benign 0.03
R3940:Pcdhga9 UTSW 18 37,871,995 (GRCm39) missense probably benign 0.03
R3946:Pcdhga9 UTSW 18 37,870,897 (GRCm39) missense probably damaging 1.00
R4576:Pcdhga9 UTSW 18 37,870,881 (GRCm39) missense probably damaging 1.00
R4617:Pcdhga9 UTSW 18 37,871,553 (GRCm39) missense probably damaging 1.00
R4810:Pcdhga9 UTSW 18 37,871,601 (GRCm39) missense possibly damaging 0.95
R4903:Pcdhga9 UTSW 18 37,872,058 (GRCm39) missense probably damaging 1.00
R4941:Pcdhga9 UTSW 18 37,871,185 (GRCm39) missense probably damaging 0.99
R5042:Pcdhga9 UTSW 18 37,870,630 (GRCm39) missense probably damaging 1.00
R5641:Pcdhga9 UTSW 18 37,871,301 (GRCm39) missense probably damaging 1.00
R5743:Pcdhga9 UTSW 18 37,871,859 (GRCm39) missense probably damaging 1.00
R6762:Pcdhga9 UTSW 18 37,870,321 (GRCm39) missense probably damaging 1.00
R7140:Pcdhga9 UTSW 18 37,872,184 (GRCm39) missense possibly damaging 0.67
R7619:Pcdhga9 UTSW 18 37,871,805 (GRCm39) missense probably damaging 1.00
R7804:Pcdhga9 UTSW 18 37,871,132 (GRCm39) missense probably damaging 1.00
R8088:Pcdhga9 UTSW 18 37,870,007 (GRCm39) intron probably benign
R8506:Pcdhga9 UTSW 18 37,871,737 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATCCATGTCCACAGAAGTTC -3'
(R):5'- AGGATCTTGGGAGCATTGTC -3'

Sequencing Primer
(F):5'- GAAGTTCACATCACCCTGTATGTGG -3'
(R):5'- GGAGCATTGTCATTCTGATCCAATAG -3'
Posted On 2015-07-06