Incidental Mutation 'R4397:Adgrg4'
ID 325568
Institutional Source Beutler Lab
Gene Symbol Adgrg4
Ensembl Gene ENSMUSG00000053852
Gene Name adhesion G protein-coupled receptor G4
Synonyms Gpr112, LOC236798, PGR17
MMRRC Submission 041685-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock # R4397 (G1)
Quality Score 222
Status Validated
Chromosome X
Chromosomal Location 56870163-57001558 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 56932343 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Valine at position 2193 (L2193V)
Ref Sequence ENSEMBL: ENSMUSP00000119486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000136396] [ENSMUST00000153784] [ENSMUST00000154818]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000136396
AA Change: L2196V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116655
Gene: ENSMUSG00000053852
AA Change: L2196V

DomainStartEndE-ValueType
SCOP:d1saca_ 2 159 5e-14 SMART
low complexity region 242 261 N/A INTRINSIC
low complexity region 310 321 N/A INTRINSIC
internal_repeat_1 459 720 5.68e-5 PROSPERO
internal_repeat_1 719 999 5.68e-5 PROSPERO
low complexity region 1013 1024 N/A INTRINSIC
low complexity region 1051 1066 N/A INTRINSIC
low complexity region 1079 1101 N/A INTRINSIC
low complexity region 1243 1261 N/A INTRINSIC
low complexity region 1346 1357 N/A INTRINSIC
low complexity region 1536 1550 N/A INTRINSIC
low complexity region 1580 1596 N/A INTRINSIC
low complexity region 1843 1864 N/A INTRINSIC
low complexity region 1892 1911 N/A INTRINSIC
low complexity region 1953 1970 N/A INTRINSIC
low complexity region 2068 2076 N/A INTRINSIC
low complexity region 2257 2269 N/A INTRINSIC
GPS 2384 2436 1.79e-18 SMART
Pfam:7tm_2 2443 2684 4.8e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000153784
AA Change: L2398V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116634
Gene: ENSMUSG00000053852
AA Change: L2398V

DomainStartEndE-ValueType
SCOP:d1saca_ 28 222 1e-17 SMART
low complexity region 305 324 N/A INTRINSIC
low complexity region 373 384 N/A INTRINSIC
internal_repeat_1 522 783 2.5e-5 PROSPERO
internal_repeat_1 782 1062 2.5e-5 PROSPERO
low complexity region 1076 1087 N/A INTRINSIC
low complexity region 1114 1129 N/A INTRINSIC
low complexity region 1142 1164 N/A INTRINSIC
low complexity region 1306 1324 N/A INTRINSIC
low complexity region 1409 1420 N/A INTRINSIC
low complexity region 1599 1613 N/A INTRINSIC
low complexity region 1643 1659 N/A INTRINSIC
low complexity region 1906 1927 N/A INTRINSIC
low complexity region 1955 1974 N/A INTRINSIC
low complexity region 2016 2033 N/A INTRINSIC
low complexity region 2131 2139 N/A INTRINSIC
low complexity region 2289 2300 N/A INTRINSIC
low complexity region 2459 2471 N/A INTRINSIC
GPS 2631 2683 1.79e-18 SMART
Pfam:7tm_2 2691 2932 8.6e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000154818
AA Change: L2193V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119486
Gene: ENSMUSG00000053852
AA Change: L2193V

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 100 119 N/A INTRINSIC
low complexity region 168 179 N/A INTRINSIC
internal_repeat_1 317 578 4.23e-5 PROSPERO
internal_repeat_1 577 857 4.23e-5 PROSPERO
low complexity region 871 882 N/A INTRINSIC
low complexity region 909 924 N/A INTRINSIC
low complexity region 937 959 N/A INTRINSIC
low complexity region 1101 1119 N/A INTRINSIC
low complexity region 1204 1215 N/A INTRINSIC
low complexity region 1394 1408 N/A INTRINSIC
low complexity region 1438 1454 N/A INTRINSIC
low complexity region 1701 1722 N/A INTRINSIC
low complexity region 1750 1769 N/A INTRINSIC
low complexity region 1811 1828 N/A INTRINSIC
low complexity region 1926 1934 N/A INTRINSIC
low complexity region 2084 2095 N/A INTRINSIC
low complexity region 2254 2266 N/A INTRINSIC
GPS 2426 2478 1.79e-18 SMART
Pfam:7tm_2 2485 2727 3.9e-52 PFAM
Meta Mutation Damage Score 0.2665 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G-protein coupled receptor belonging to a large family of diverse integral membrane proteins that participate in various physiological functions. Members of this superfamily are characterized by a signature 7-transmembrane domain motif. The ligand for this family member is unknown, and it is therefore an orphan receptor. This receptor is known to be expressed in normal enterochromaffin cells and in gastrointestinal neuroendocrine carcinoma cells, and it is therefore considered to be a novel biomarker or target for immunotherapy. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 G A 10: 127,090,483 A866T unknown Het
Aig1 A C 10: 13,652,982 S237A probably benign Het
Baz1b C T 5: 135,244,446 R1475W probably damaging Het
Bmp1 C T 14: 70,490,542 probably null Het
Crybg3 A G 16: 59,560,095 probably benign Het
Dnajc15 T C 14: 77,874,794 probably null Het
Fam135b T A 15: 71,448,676 H1334L probably benign Het
Fancg A T 4: 43,008,897 H113Q probably benign Het
Gfap G A 11: 102,896,984 A45V probably benign Het
Gjd3 A T 11: 98,982,421 L199Q probably damaging Het
Gm8979 A G 7: 106,082,923 noncoding transcript Het
H13 A G 2: 152,677,552 D65G probably damaging Het
Hcls1 T C 16: 36,937,300 V5A possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Homer3 G A 8: 70,290,143 probably null Het
Iqgap3 T C 3: 88,104,358 Y817H probably damaging Het
Iqsec2 C T X: 152,209,053 T562I probably damaging Het
Klb A G 5: 65,380,039 Y904C probably damaging Het
Kremen1 A T 11: 5,199,610 S354T probably benign Het
Lamc3 A G 2: 31,931,952 E1304G probably benign Het
Lrp4 T C 2: 91,511,670 V1876A probably benign Het
Magi3 T C 3: 104,219,714 T85A probably damaging Het
Map3k12 C T 15: 102,501,259 A694T probably benign Het
Mex3b T C 7: 82,869,823 S449P possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nars2 T C 7: 96,973,564 probably null Het
Nlrp1a T G 11: 71,097,204 M1046L probably benign Het
Nphs1 T G 7: 30,481,965 probably null Het
Nup133 G A 8: 123,944,301 T119M probably benign Het
Olfr770 G T 10: 129,133,581 N62K possibly damaging Het
Pcdhga9 A T 18: 37,738,641 I508F probably damaging Het
Phactr3 A G 2: 178,175,406 probably benign Het
Plcb3 T C 19: 6,965,825 K155E probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Prss38 T C 11: 59,373,028 Y286C probably damaging Het
Psg16 T C 7: 17,090,698 S45P possibly damaging Het
Ptpn21 G T 12: 98,688,248 P820Q probably damaging Het
Ptpn21 A G 12: 98,715,060 V105A probably damaging Het
Rnf7 A G 9: 96,478,410 M58T probably benign Het
Slc25a11 G A 11: 70,644,851 A287V probably benign Het
Slit2 G T 5: 48,220,081 probably null Het
Suco A G 1: 161,844,852 Y460H probably damaging Het
Tnxb C T 17: 34,678,662 Q804* probably null Het
Trpv6 A G 6: 41,625,238 I379T possibly damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Virma A G 4: 11,513,901 E585G possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Vmn2r88 A T 14: 51,417,978 D549V probably damaging Het
Other mutations in Adgrg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03215:Adgrg4 APN X 56977596 missense probably damaging 1.00
R3407:Adgrg4 UTSW X 56968127 missense probably damaging 0.97
R3408:Adgrg4 UTSW X 56968127 missense probably damaging 0.97
R3947:Adgrg4 UTSW X 56917754 missense probably benign 0.25
R3948:Adgrg4 UTSW X 56917754 missense probably benign 0.25
R4067:Adgrg4 UTSW X 56959960 missense probably damaging 1.00
R4207:Adgrg4 UTSW X 56918749 missense possibly damaging 0.92
R4393:Adgrg4 UTSW X 56932343 missense probably damaging 1.00
R4395:Adgrg4 UTSW X 56932343 missense probably damaging 1.00
R4504:Adgrg4 UTSW X 56916442 missense possibly damaging 0.63
Z1176:Adgrg4 UTSW X 56894702 missense probably benign 0.00
Z1176:Adgrg4 UTSW X 56914259 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGGACAGGCCTTCCATTATTG -3'
(R):5'- ATGGGCTGCTGTGAGGTAAC -3'

Sequencing Primer
(F):5'- GCTGATACCCATGGTAACCTTCATAG -3'
(R):5'- ACTTTTCATAGAGTGAGTTCTGCC -3'
Posted On 2015-07-06