Incidental Mutation 'R4397:Iqsec2'
ID 325569
Institutional Source Beutler Lab
Gene Symbol Iqsec2
Ensembl Gene ENSMUSG00000041115
Gene Name IQ motif and Sec7 domain 2
Synonyms
MMRRC Submission 041685-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.405) question?
Stock # R4397 (G1)
Quality Score 222
Status Validated
Chromosome X
Chromosomal Location 150927193-151008232 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 150992049 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 562 (T562I)
Ref Sequence ENSEMBL: ENSMUSP00000127249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096275] [ENSMUST00000112604] [ENSMUST00000112605] [ENSMUST00000168786]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000096275
AA Change: T357I

PolyPhen 2 Score 0.355 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000093995
Gene: ENSMUSG00000041115
AA Change: T357I

DomainStartEndE-ValueType
low complexity region 164 177 N/A INTRINSIC
low complexity region 228 246 N/A INTRINSIC
low complexity region 309 334 N/A INTRINSIC
low complexity region 343 355 N/A INTRINSIC
low complexity region 395 410 N/A INTRINSIC
low complexity region 444 461 N/A INTRINSIC
low complexity region 491 515 N/A INTRINSIC
Sec7 545 736 2.19e-88 SMART
PH 767 878 6.87e-3 SMART
Blast:Sec7 886 931 3e-18 BLAST
low complexity region 932 946 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112604
AA Change: T562I

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108223
Gene: ENSMUSG00000041115
AA Change: T562I

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
coiled coil region 23 74 N/A INTRINSIC
low complexity region 167 174 N/A INTRINSIC
low complexity region 206 232 N/A INTRINSIC
low complexity region 369 382 N/A INTRINSIC
low complexity region 433 451 N/A INTRINSIC
low complexity region 514 539 N/A INTRINSIC
low complexity region 548 560 N/A INTRINSIC
low complexity region 600 615 N/A INTRINSIC
low complexity region 649 666 N/A INTRINSIC
low complexity region 696 720 N/A INTRINSIC
Sec7 750 941 2.19e-88 SMART
PH 972 1083 6.87e-3 SMART
Blast:Sec7 1091 1136 3e-18 BLAST
low complexity region 1137 1151 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112605
AA Change: T562I

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108224
Gene: ENSMUSG00000041115
AA Change: T562I

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
coiled coil region 23 74 N/A INTRINSIC
low complexity region 167 174 N/A INTRINSIC
low complexity region 206 232 N/A INTRINSIC
low complexity region 369 382 N/A INTRINSIC
low complexity region 433 451 N/A INTRINSIC
low complexity region 514 539 N/A INTRINSIC
low complexity region 548 560 N/A INTRINSIC
low complexity region 600 615 N/A INTRINSIC
low complexity region 649 666 N/A INTRINSIC
low complexity region 696 720 N/A INTRINSIC
Sec7 750 941 2.19e-88 SMART
PH 972 1083 6.87e-3 SMART
Blast:Sec7 1091 1136 4e-18 BLAST
low complexity region 1137 1151 N/A INTRINSIC
low complexity region 1201 1211 N/A INTRINSIC
low complexity region 1228 1253 N/A INTRINSIC
low complexity region 1273 1318 N/A INTRINSIC
low complexity region 1337 1349 N/A INTRINSIC
low complexity region 1392 1462 N/A INTRINSIC
low complexity region 1470 1482 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168786
AA Change: T562I

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127249
Gene: ENSMUSG00000041115
AA Change: T562I

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
coiled coil region 23 74 N/A INTRINSIC
low complexity region 167 174 N/A INTRINSIC
low complexity region 206 232 N/A INTRINSIC
low complexity region 369 382 N/A INTRINSIC
low complexity region 433 451 N/A INTRINSIC
low complexity region 514 539 N/A INTRINSIC
low complexity region 548 560 N/A INTRINSIC
low complexity region 600 615 N/A INTRINSIC
low complexity region 649 666 N/A INTRINSIC
low complexity region 696 720 N/A INTRINSIC
Sec7 750 941 2.19e-88 SMART
Blast:PH 972 1074 7e-61 BLAST
Blast:Sec7 1082 1127 4e-18 BLAST
low complexity region 1128 1142 N/A INTRINSIC
low complexity region 1192 1202 N/A INTRINSIC
low complexity region 1219 1244 N/A INTRINSIC
low complexity region 1264 1309 N/A INTRINSIC
low complexity region 1328 1340 N/A INTRINSIC
low complexity region 1383 1453 N/A INTRINSIC
low complexity region 1461 1473 N/A INTRINSIC
Meta Mutation Damage Score 0.0684 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanine nucleotide exchange factor for the ARF family of small GTP-binding proteins. The encoded protein is a component of the postsynaptic density at excitatory synapses, and may play a critical role in cytoskeletal and synaptic organization through the activation of selected ARF substrates including ARF1 and ARF6. Mutations in this gene have been implicated in nonsyndromic X-linked mental retardation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg4 T G X: 55,977,703 (GRCm39) L2193V probably damaging Het
Agap2 G A 10: 126,926,352 (GRCm39) A866T unknown Het
Aig1 A C 10: 13,528,726 (GRCm39) S237A probably benign Het
Baz1b C T 5: 135,273,300 (GRCm39) R1475W probably damaging Het
Bmp1 C T 14: 70,727,982 (GRCm39) probably null Het
Crybg3 A G 16: 59,380,458 (GRCm39) probably benign Het
Dnajc15 T C 14: 78,112,234 (GRCm39) probably null Het
Fam135b T A 15: 71,320,525 (GRCm39) H1334L probably benign Het
Fancg A T 4: 43,008,897 (GRCm39) H113Q probably benign Het
Gfap G A 11: 102,787,810 (GRCm39) A45V probably benign Het
Gjd3 A T 11: 98,873,247 (GRCm39) L199Q probably damaging Het
Gvin-ps3 A G 7: 105,682,130 (GRCm39) noncoding transcript Het
H13 A G 2: 152,519,472 (GRCm39) D65G probably damaging Het
Hcls1 T C 16: 36,757,662 (GRCm39) V5A possibly damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Homer3 G A 8: 70,742,793 (GRCm39) probably null Het
Iqgap3 T C 3: 88,011,665 (GRCm39) Y817H probably damaging Het
Klb A G 5: 65,537,382 (GRCm39) Y904C probably damaging Het
Kremen1 A T 11: 5,149,610 (GRCm39) S354T probably benign Het
Lamc3 A G 2: 31,821,964 (GRCm39) E1304G probably benign Het
Lrp4 T C 2: 91,342,015 (GRCm39) V1876A probably benign Het
Magi3 T C 3: 104,127,030 (GRCm39) T85A probably damaging Het
Map3k12 C T 15: 102,409,694 (GRCm39) A694T probably benign Het
Mex3b T C 7: 82,519,031 (GRCm39) S449P possibly damaging Het
Naip6 C T 13: 100,437,108 (GRCm39) A472T probably benign Het
Nars2 T C 7: 96,622,771 (GRCm39) probably null Het
Nlrp1a T G 11: 70,988,030 (GRCm39) M1046L probably benign Het
Nphs1 T G 7: 30,181,390 (GRCm39) probably null Het
Nup133 G A 8: 124,671,040 (GRCm39) T119M probably benign Het
Or6c201 G T 10: 128,969,450 (GRCm39) N62K possibly damaging Het
Pcdhga9 A T 18: 37,871,694 (GRCm39) I508F probably damaging Het
Phactr3 A G 2: 177,817,199 (GRCm39) probably benign Het
Plcb3 T C 19: 6,943,193 (GRCm39) K155E probably damaging Het
Plxna2 C T 1: 194,431,625 (GRCm39) S538F probably damaging Het
Prss38 T C 11: 59,263,854 (GRCm39) Y286C probably damaging Het
Psg16 T C 7: 16,824,623 (GRCm39) S45P possibly damaging Het
Ptpn21 G T 12: 98,654,507 (GRCm39) P820Q probably damaging Het
Ptpn21 A G 12: 98,681,319 (GRCm39) V105A probably damaging Het
Rnf7 A G 9: 96,360,463 (GRCm39) M58T probably benign Het
Slc25a11 G A 11: 70,535,677 (GRCm39) A287V probably benign Het
Slit2 G T 5: 48,377,423 (GRCm39) probably null Het
Suco A G 1: 161,672,421 (GRCm39) Y460H probably damaging Het
Tnxb C T 17: 34,897,636 (GRCm39) Q804* probably null Het
Trpv6 A G 6: 41,602,172 (GRCm39) I379T possibly damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,139,706 (GRCm39) probably benign Het
Virma A G 4: 11,513,901 (GRCm39) E585G possibly damaging Het
Vmn2r79 A G 7: 86,651,099 (GRCm39) H166R possibly damaging Het
Vmn2r88 A T 14: 51,655,435 (GRCm39) D549V probably damaging Het
Other mutations in Iqsec2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0193:Iqsec2 UTSW X 151,006,399 (GRCm39) missense probably benign 0.33
R0675:Iqsec2 UTSW X 150,987,120 (GRCm39) missense possibly damaging 0.76
R1169:Iqsec2 UTSW X 150,927,727 (GRCm39) missense probably benign 0.01
R1171:Iqsec2 UTSW X 150,927,727 (GRCm39) missense probably benign 0.01
R4395:Iqsec2 UTSW X 150,992,049 (GRCm39) missense probably damaging 0.98
R4553:Iqsec2 UTSW X 150,994,277 (GRCm39) missense probably benign 0.03
X0026:Iqsec2 UTSW X 150,992,646 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATTGATGAGGCCCTGAACTG -3'
(R):5'- TCAGCCTCATACACCAGCTG -3'

Sequencing Primer
(F):5'- CATCAGGGCCTATGTCTGAG -3'
(R):5'- TCATACACCAGCTGGCGGTG -3'
Posted On 2015-07-06