Incidental Mutation 'R4398:Prim2'
ID325571
Institutional Source Beutler Lab
Gene Symbol Prim2
Ensembl Gene ENSMUSG00000026134
Gene NameDNA primase, p58 subunit
Synonyms
MMRRC Submission 041130-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.921) question?
Stock #R4398 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location33453810-33669795 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33512111 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 309 (Y309H)
Ref Sequence ENSEMBL: ENSMUSP00000027312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027312]
Predicted Effect probably damaging
Transcript: ENSMUST00000027312
AA Change: Y309H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027312
Gene: ENSMUSG00000026134
AA Change: Y309H

DomainStartEndE-ValueType
Pfam:DNA_primase_lrg 182 448 6.2e-99 PFAM
low complexity region 482 503 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189552
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the 58 kilodalton subunit of DNA primase, an enzyme that plays a key role in the replication of DNA. The encoded protein forms a heterodimer with a 49 kilodalton subunit. This heterodimer functions as a DNA-directed RNA polymerase to synthesize small RNA primers that are used to create Okazaki fragments on the lagging strand of the DNA. Alternative splicing of this gene results in multiple transcript variants. This gene has a related pseudogene, which is also present on chromosome 6. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 C A 15: 94,333,695 R871L possibly damaging Het
Adcy5 G A 16: 35,268,993 C520Y probably damaging Het
AI661453 G A 17: 47,468,117 probably benign Het
Bptf T C 11: 107,110,844 K481E probably damaging Het
Cnot10 T A 9: 114,631,881 K74* probably null Het
Ctc1 C T 11: 69,022,871 P200S probably damaging Het
Dact1 T C 12: 71,317,185 Y210H probably damaging Het
Dbn1 T C 13: 55,475,381 T430A probably benign Het
Dmd A C X: 83,722,018 T657P probably benign Het
Efnb2 C T 8: 8,620,832 R256H possibly damaging Het
Eif4a1 T C 11: 69,669,244 I116M possibly damaging Het
F730035P03Rik A T 7: 99,780,268 noncoding transcript Het
Fbn1 C T 2: 125,397,781 V329I probably benign Het
Gpr20 G A 15: 73,696,276 T88I probably benign Het
Herc1 T G 9: 66,479,453 V3783G probably benign Het
Khdc1a A G 1: 21,350,393 D79G possibly damaging Het
Klk1b16 A T 7: 44,141,427 I218F probably damaging Het
Malrd1 C T 2: 16,150,783 T2001I unknown Het
Mia3 A G 1: 183,330,878 S556P probably damaging Het
Myo3a T A 2: 22,577,842 D369E probably benign Het
Nelfa T C 5: 33,901,279 D279G possibly damaging Het
Ntrk3 A T 7: 78,250,769 C607* probably null Het
Olfr53 T C 7: 140,652,828 V283A possibly damaging Het
Pclo A T 5: 14,775,366 Q1371L probably damaging Het
Pdzd2 A T 15: 12,375,975 V1358E probably benign Het
Pgr T C 9: 8,903,749 probably null Het
Prag1 A G 8: 36,103,655 D464G probably damaging Het
Prickle4 A G 17: 47,690,531 probably benign Het
Prkaa1 A G 15: 5,177,161 Q464R possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rint1 T A 5: 23,794,447 I78K possibly damaging Het
Rnf130 T A 11: 50,071,378 F217Y probably benign Het
Smad7 T C 18: 75,394,163 V360A probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Stag1 A G 9: 100,956,606 probably benign Het
Tlr12 T A 4: 128,616,195 D754V probably benign Het
Tmf1 G A 6: 97,178,896 P43L probably damaging Het
Togaram1 A G 12: 64,980,856 N873S probably benign Het
Tsn C T 1: 118,311,069 probably benign Het
Ubn1 A G 16: 5,064,425 K250R probably damaging Het
Vmn1r25 A T 6: 57,978,827 V159D probably damaging Het
Vmn2r89 T C 14: 51,452,094 L18P probably damaging Het
Vps8 T G 16: 21,504,466 N689K probably damaging Het
Ythdc1 T A 5: 86,815,654 D30E possibly damaging Het
Ythdc1 G T 5: 86,835,820 probably benign Het
Zfp407 G A 18: 84,562,731 Q86* probably null Het
Zfp521 C T 18: 13,846,544 E271K probably benign Het
Other mutations in Prim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Prim2 APN 1 33512160 missense probably damaging 1.00
IGL02576:Prim2 APN 1 33484717 missense probably damaging 1.00
R0398:Prim2 UTSW 1 33484676 splice site probably benign
R0686:Prim2 UTSW 1 33514189 missense probably benign
R1452:Prim2 UTSW 1 33630404 missense probably benign
R3925:Prim2 UTSW 1 33533299 missense probably damaging 1.00
R4831:Prim2 UTSW 1 33670136 unclassified probably benign
R4832:Prim2 UTSW 1 33464064 missense probably benign
R5057:Prim2 UTSW 1 33630360 nonsense probably null
R5240:Prim2 UTSW 1 33480316 intron probably benign
R5294:Prim2 UTSW 1 33668893 missense probably benign 0.11
R5771:Prim2 UTSW 1 33454151 missense unknown
R5807:Prim2 UTSW 1 33480406 intron probably benign
R6307:Prim2 UTSW 1 33662292 missense probably benign 0.00
R7165:Prim2 UTSW 1 33628393 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACTTTTACCTGTGTTTCAGTGCATA -3'
(R):5'- TTAGTCAAATCTACAGTCACAGCA -3'

Sequencing Primer
(F):5'- GCAATCACATGGTGGTTCAC -3'
(R):5'- AGTCACAGCAAATATGACATGTGGTC -3'
Posted On2015-07-06