Incidental Mutation 'R4398:Rint1'
ID 325579
Institutional Source Beutler Lab
Gene Symbol Rint1
Ensembl Gene ENSMUSG00000028999
Gene Name RAD50 interactor 1
Synonyms 2810450M21Rik, 1500019C06Rik
MMRRC Submission 041130-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4398 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 23787711-23820369 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 23794447 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 78 (I78K)
Ref Sequence ENSEMBL: ENSMUSP00000110766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030852] [ENSMUST00000115113] [ENSMUST00000117783] [ENSMUST00000120869]
AlphaFold Q8BZ36
Predicted Effect possibly damaging
Transcript: ENSMUST00000030852
AA Change: I78K

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000030852
Gene: ENSMUSG00000028999
AA Change: I78K

DomainStartEndE-ValueType
Pfam:RINT1_TIP1 304 784 2.3e-135 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112256
Predicted Effect possibly damaging
Transcript: ENSMUST00000115113
AA Change: I78K

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110766
Gene: ENSMUSG00000028999
AA Change: I78K

DomainStartEndE-ValueType
Pfam:RINT1_TIP1 246 727 1.2e-161 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117783
Predicted Effect probably benign
Transcript: ENSMUST00000120869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199495
Meta Mutation Damage Score 0.2486 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein first identified for its ability to interact with the RAD50 double strand break repair protein, with the resulting interaction implicated in the regulation of cell cycle progression and telomere length. The encoded protein may also play a role in trafficking of cellular cargo from the endosome to the trans-Golgi network. Mutations in this gene may be associated with breast cancer in human patients. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a mutant allele exhibit early embryonic lethality. Mice heterozygous for a mutant allele exhibit premature death with a life span of 24 months and increased multiple tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 C A 15: 94,333,695 R871L possibly damaging Het
Adcy5 G A 16: 35,268,993 C520Y probably damaging Het
AI661453 G A 17: 47,468,117 probably benign Het
Bptf T C 11: 107,110,844 K481E probably damaging Het
Cnot10 T A 9: 114,631,881 K74* probably null Het
Ctc1 C T 11: 69,022,871 P200S probably damaging Het
Dact1 T C 12: 71,317,185 Y210H probably damaging Het
Dbn1 T C 13: 55,475,381 T430A probably benign Het
Dmd A C X: 83,722,018 T657P probably benign Het
Efnb2 C T 8: 8,620,832 R256H possibly damaging Het
Eif4a1 T C 11: 69,669,244 I116M possibly damaging Het
F730035P03Rik A T 7: 99,780,268 noncoding transcript Het
Fbn1 C T 2: 125,397,781 V329I probably benign Het
Gpr20 G A 15: 73,696,276 T88I probably benign Het
Herc1 T G 9: 66,479,453 V3783G probably benign Het
Khdc1a A G 1: 21,350,393 D79G possibly damaging Het
Klk1b16 A T 7: 44,141,427 I218F probably damaging Het
Malrd1 C T 2: 16,150,783 T2001I unknown Het
Mia3 A G 1: 183,330,878 S556P probably damaging Het
Myo3a T A 2: 22,577,842 D369E probably benign Het
Nelfa T C 5: 33,901,279 D279G possibly damaging Het
Ntrk3 A T 7: 78,250,769 C607* probably null Het
Olfr53 T C 7: 140,652,828 V283A possibly damaging Het
Pclo A T 5: 14,775,366 Q1371L probably damaging Het
Pdzd2 A T 15: 12,375,975 V1358E probably benign Het
Pgr T C 9: 8,903,749 probably null Het
Prag1 A G 8: 36,103,655 D464G probably damaging Het
Prickle4 A G 17: 47,690,531 probably benign Het
Prim2 A G 1: 33,512,111 Y309H probably damaging Het
Prkaa1 A G 15: 5,177,161 Q464R possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rnf130 T A 11: 50,071,378 F217Y probably benign Het
Smad7 T C 18: 75,394,163 V360A probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Stag1 A G 9: 100,956,606 probably benign Het
Tlr12 T A 4: 128,616,195 D754V probably benign Het
Tmf1 G A 6: 97,178,896 P43L probably damaging Het
Togaram1 A G 12: 64,980,856 N873S probably benign Het
Tsn C T 1: 118,311,069 probably benign Het
Ubn1 A G 16: 5,064,425 K250R probably damaging Het
Vmn1r25 A T 6: 57,978,827 V159D probably damaging Het
Vmn2r89 T C 14: 51,452,094 L18P probably damaging Het
Vps8 T G 16: 21,504,466 N689K probably damaging Het
Ythdc1 T A 5: 86,815,654 D30E possibly damaging Het
Ythdc1 G T 5: 86,835,820 probably benign Het
Zfp407 G A 18: 84,562,731 Q86* probably null Het
Zfp521 C T 18: 13,846,544 E271K probably benign Het
Other mutations in Rint1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Rint1 APN 5 23794431 missense probably benign 0.00
IGL00596:Rint1 APN 5 23811865 missense probably damaging 0.99
IGL01685:Rint1 APN 5 23787834 unclassified probably benign
IGL02428:Rint1 APN 5 23794452 nonsense probably null
IGL03007:Rint1 APN 5 23815701 missense probably benign 0.00
IGL03280:Rint1 APN 5 23817078 missense probably damaging 1.00
breakage UTSW 5 23800722 missense probably damaging 0.99
IGL02799:Rint1 UTSW 5 23819480 missense possibly damaging 0.93
R0062:Rint1 UTSW 5 23787828 unclassified probably benign
R0243:Rint1 UTSW 5 23816932 splice site probably benign
R1102:Rint1 UTSW 5 23805567 splice site probably benign
R1552:Rint1 UTSW 5 23800658 missense probably benign 0.00
R1729:Rint1 UTSW 5 23809843 missense probably benign 0.00
R1784:Rint1 UTSW 5 23809843 missense probably benign 0.00
R2070:Rint1 UTSW 5 23810929 missense possibly damaging 0.94
R2920:Rint1 UTSW 5 23805402 missense probably benign 0.00
R3114:Rint1 UTSW 5 23819420 missense probably benign 0.27
R4756:Rint1 UTSW 5 23809793 missense probably damaging 1.00
R5246:Rint1 UTSW 5 23800811 missense probably damaging 0.99
R5452:Rint1 UTSW 5 23794365 missense probably benign 0.01
R5566:Rint1 UTSW 5 23810953 missense probably damaging 1.00
R5709:Rint1 UTSW 5 23815833 missense probably damaging 0.98
R6524:Rint1 UTSW 5 23815739 missense probably benign 0.00
R7346:Rint1 UTSW 5 23815653 missense possibly damaging 0.82
R7549:Rint1 UTSW 5 23815704 missense probably benign
R7634:Rint1 UTSW 5 23805479 missense probably benign 0.00
R7647:Rint1 UTSW 5 23800802 missense probably damaging 1.00
R7885:Rint1 UTSW 5 23805644 missense probably benign
R7895:Rint1 UTSW 5 23800722 missense probably damaging 0.99
R8347:Rint1 UTSW 5 23811772 missense probably damaging 1.00
R8791:Rint1 UTSW 5 23800596 missense probably damaging 0.99
R8900:Rint1 UTSW 5 23811884 missense possibly damaging 0.77
R8916:Rint1 UTSW 5 23787828 unclassified probably benign
R8973:Rint1 UTSW 5 23811730 missense probably benign 0.00
R9245:Rint1 UTSW 5 23805413 missense probably benign
R9339:Rint1 UTSW 5 23788357 makesense probably null
R9630:Rint1 UTSW 5 23815812 missense possibly damaging 0.82
R9718:Rint1 UTSW 5 23800723 missense possibly damaging 0.53
Z1088:Rint1 UTSW 5 23805314 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGGATATGTCTCCTTAAATGATCAGG -3'
(R):5'- TCTCTCAGTTTGAGGCTTGC -3'

Sequencing Primer
(F):5'- ACCTGTAGACTGTACTTGATAGGCC -3'
(R):5'- CCCTCATGGCCTGCATCG -3'
Posted On 2015-07-06