Incidental Mutation 'R4398:Olfr53'
ID325586
Institutional Source Beutler Lab
Gene Symbol Olfr53
Ensembl Gene ENSMUSG00000094819
Gene Nameolfactory receptor 53
SynonymsGA_x6K02T2PBJ9-42798103-42799038, IE12, MOR253-5
MMRRC Submission 041130-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R4398 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location140646452-140653085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 140652828 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 283 (V283A)
Ref Sequence ENSEMBL: ENSMUSP00000081494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084456] [ENSMUST00000211057] [ENSMUST00000211399]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084456
AA Change: V283A

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000081494
Gene: ENSMUSG00000094819
AA Change: V283A

DomainStartEndE-ValueType
Pfam:7tm_4 33 309 6.5e-51 PFAM
Pfam:7TM_GPCR_Srsx 37 208 9.7e-7 PFAM
Pfam:7tm_1 43 292 1.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211057
Predicted Effect probably benign
Transcript: ENSMUST00000211399
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 C A 15: 94,333,695 R871L possibly damaging Het
Adcy5 G A 16: 35,268,993 C520Y probably damaging Het
AI661453 G A 17: 47,468,117 probably benign Het
Bptf T C 11: 107,110,844 K481E probably damaging Het
Cnot10 T A 9: 114,631,881 K74* probably null Het
Ctc1 C T 11: 69,022,871 P200S probably damaging Het
Dact1 T C 12: 71,317,185 Y210H probably damaging Het
Dbn1 T C 13: 55,475,381 T430A probably benign Het
Dmd A C X: 83,722,018 T657P probably benign Het
Efnb2 C T 8: 8,620,832 R256H possibly damaging Het
Eif4a1 T C 11: 69,669,244 I116M possibly damaging Het
F730035P03Rik A T 7: 99,780,268 noncoding transcript Het
Fbn1 C T 2: 125,397,781 V329I probably benign Het
Gpr20 G A 15: 73,696,276 T88I probably benign Het
Herc1 T G 9: 66,479,453 V3783G probably benign Het
Khdc1a A G 1: 21,350,393 D79G possibly damaging Het
Klk1b16 A T 7: 44,141,427 I218F probably damaging Het
Malrd1 C T 2: 16,150,783 T2001I unknown Het
Mia3 A G 1: 183,330,878 S556P probably damaging Het
Myo3a T A 2: 22,577,842 D369E probably benign Het
Nelfa T C 5: 33,901,279 D279G possibly damaging Het
Ntrk3 A T 7: 78,250,769 C607* probably null Het
Pclo A T 5: 14,775,366 Q1371L probably damaging Het
Pdzd2 A T 15: 12,375,975 V1358E probably benign Het
Pgr T C 9: 8,903,749 probably null Het
Prag1 A G 8: 36,103,655 D464G probably damaging Het
Prickle4 A G 17: 47,690,531 probably benign Het
Prim2 A G 1: 33,512,111 Y309H probably damaging Het
Prkaa1 A G 15: 5,177,161 Q464R possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rint1 T A 5: 23,794,447 I78K possibly damaging Het
Rnf130 T A 11: 50,071,378 F217Y probably benign Het
Smad7 T C 18: 75,394,163 V360A probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Stag1 A G 9: 100,956,606 probably benign Het
Tlr12 T A 4: 128,616,195 D754V probably benign Het
Tmf1 G A 6: 97,178,896 P43L probably damaging Het
Togaram1 A G 12: 64,980,856 N873S probably benign Het
Tsn C T 1: 118,311,069 probably benign Het
Ubn1 A G 16: 5,064,425 K250R probably damaging Het
Vmn1r25 A T 6: 57,978,827 V159D probably damaging Het
Vmn2r89 T C 14: 51,452,094 L18P probably damaging Het
Vps8 T G 16: 21,504,466 N689K probably damaging Het
Ythdc1 T A 5: 86,815,654 D30E possibly damaging Het
Ythdc1 G T 5: 86,835,820 probably benign Het
Zfp407 G A 18: 84,562,731 Q86* probably null Het
Zfp521 C T 18: 13,846,544 E271K probably benign Het
Other mutations in Olfr53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Olfr53 APN 7 140652476 missense probably benign 0.00
IGL01071:Olfr53 APN 7 140652914 missense possibly damaging 0.76
IGL02590:Olfr53 APN 7 140652392 unclassified probably null
IGL02694:Olfr53 APN 7 140652180 missense probably damaging 0.99
R0071:Olfr53 UTSW 7 140652257 missense probably benign 0.00
R0071:Olfr53 UTSW 7 140652257 missense probably benign 0.00
R0089:Olfr53 UTSW 7 140652311 missense probably damaging 0.99
R0586:Olfr53 UTSW 7 140652063 missense probably benign 0.35
R1209:Olfr53 UTSW 7 140652014 missense probably benign 0.03
R1491:Olfr53 UTSW 7 140652737 missense probably damaging 1.00
R1781:Olfr53 UTSW 7 140652506 missense probably damaging 0.99
R4060:Olfr53 UTSW 7 140652120 missense probably damaging 1.00
R4231:Olfr53 UTSW 7 140652740 missense probably damaging 1.00
R4236:Olfr53 UTSW 7 140652740 missense probably damaging 1.00
R4299:Olfr53 UTSW 7 140652243 missense probably benign 0.00
R4675:Olfr53 UTSW 7 140652161 missense probably damaging 1.00
R4937:Olfr53 UTSW 7 140652621 missense probably benign 0.00
R5854:Olfr53 UTSW 7 140652578 missense probably benign 0.03
R6124:Olfr53 UTSW 7 140652594 missense probably damaging 1.00
R7092:Olfr53 UTSW 7 140652237 missense probably benign 0.16
R7167:Olfr53 UTSW 7 140652553 nonsense probably null
R7846:Olfr53 UTSW 7 140652461 missense probably damaging 0.96
R7896:Olfr53 UTSW 7 140652901 missense probably benign 0.00
R7929:Olfr53 UTSW 7 140652461 missense probably damaging 0.96
R7979:Olfr53 UTSW 7 140652901 missense probably benign 0.00
Z1177:Olfr53 UTSW 7 140652787 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TGTCTTTCTGGGAGGCATCAAC -3'
(R):5'- ATGCTCCATGAAGCTGCTC -3'

Sequencing Primer
(F):5'- GGGAGGCATCAACTTCATGTTAACC -3'
(R):5'- CTCCATGAAGCTGCTCTTAGGAAAG -3'
Posted On2015-07-06