Incidental Mutation 'R4398:Rnf130'
ID325594
Institutional Source Beutler Lab
Gene Symbol Rnf130
Ensembl Gene ENSMUSG00000020376
Gene Namering finger protein 130
SynonymsG1RZFP, G1RP, 2510042A13Rik
MMRRC Submission 041130-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R4398 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location50025346-50104758 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50071378 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 217 (F217Y)
Ref Sequence ENSEMBL: ENSMUSP00000056345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054684] [ENSMUST00000102776]
Predicted Effect probably benign
Transcript: ENSMUST00000054684
AA Change: F217Y

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000056345
Gene: ENSMUSG00000020376
AA Change: F217Y

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
Pfam:PA 65 169 4.6e-13 PFAM
transmembrane domain 195 217 N/A INTRINSIC
RING 264 304 5.51e-7 SMART
low complexity region 341 354 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083483
Predicted Effect probably benign
Transcript: ENSMUST00000102776
AA Change: F217Y

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000099837
Gene: ENSMUSG00000020376
AA Change: F217Y

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
Pfam:PA 69 167 8.1e-14 PFAM
transmembrane domain 195 217 N/A INTRINSIC
RING 264 304 5.51e-7 SMART
low complexity region 341 354 N/A INTRINSIC
transmembrane domain 387 409 N/A INTRINSIC
Meta Mutation Damage Score 0.0603 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger motif and is similar to g1, a Drosophila zinc-finger protein that is expressed in mesoderm and involved in embryonic development. The expression of the mouse counterpart was found to be upregulated in myeloblastic cells following IL3 deprivation, suggesting that this gene may regulate growth factor withdrawal-induced apoptosis of myeloid precursor cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 C A 15: 94,333,695 R871L possibly damaging Het
Adcy5 G A 16: 35,268,993 C520Y probably damaging Het
AI661453 G A 17: 47,468,117 probably benign Het
Bptf T C 11: 107,110,844 K481E probably damaging Het
Cnot10 T A 9: 114,631,881 K74* probably null Het
Ctc1 C T 11: 69,022,871 P200S probably damaging Het
Dact1 T C 12: 71,317,185 Y210H probably damaging Het
Dbn1 T C 13: 55,475,381 T430A probably benign Het
Dmd A C X: 83,722,018 T657P probably benign Het
Efnb2 C T 8: 8,620,832 R256H possibly damaging Het
Eif4a1 T C 11: 69,669,244 I116M possibly damaging Het
F730035P03Rik A T 7: 99,780,268 noncoding transcript Het
Fbn1 C T 2: 125,397,781 V329I probably benign Het
Gpr20 G A 15: 73,696,276 T88I probably benign Het
Herc1 T G 9: 66,479,453 V3783G probably benign Het
Khdc1a A G 1: 21,350,393 D79G possibly damaging Het
Klk1b16 A T 7: 44,141,427 I218F probably damaging Het
Malrd1 C T 2: 16,150,783 T2001I unknown Het
Mia3 A G 1: 183,330,878 S556P probably damaging Het
Myo3a T A 2: 22,577,842 D369E probably benign Het
Nelfa T C 5: 33,901,279 D279G possibly damaging Het
Ntrk3 A T 7: 78,250,769 C607* probably null Het
Olfr53 T C 7: 140,652,828 V283A possibly damaging Het
Pclo A T 5: 14,775,366 Q1371L probably damaging Het
Pdzd2 A T 15: 12,375,975 V1358E probably benign Het
Pgr T C 9: 8,903,749 probably null Het
Prag1 A G 8: 36,103,655 D464G probably damaging Het
Prickle4 A G 17: 47,690,531 probably benign Het
Prim2 A G 1: 33,512,111 Y309H probably damaging Het
Prkaa1 A G 15: 5,177,161 Q464R possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rint1 T A 5: 23,794,447 I78K possibly damaging Het
Smad7 T C 18: 75,394,163 V360A probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Stag1 A G 9: 100,956,606 probably benign Het
Tlr12 T A 4: 128,616,195 D754V probably benign Het
Tmf1 G A 6: 97,178,896 P43L probably damaging Het
Togaram1 A G 12: 64,980,856 N873S probably benign Het
Tsn C T 1: 118,311,069 probably benign Het
Ubn1 A G 16: 5,064,425 K250R probably damaging Het
Vmn1r25 A T 6: 57,978,827 V159D probably damaging Het
Vmn2r89 T C 14: 51,452,094 L18P probably damaging Het
Vps8 T G 16: 21,504,466 N689K probably damaging Het
Ythdc1 T A 5: 86,815,654 D30E possibly damaging Het
Ythdc1 G T 5: 86,835,820 probably benign Het
Zfp407 G A 18: 84,562,731 Q86* probably null Het
Zfp521 C T 18: 13,846,544 E271K probably benign Het
Other mutations in Rnf130
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Rnf130 APN 11 50093796 missense probably damaging 1.00
IGL02364:Rnf130 APN 11 50095840 missense probably benign
IGL02948:Rnf130 APN 11 50052771 splice site probably benign
R0145:Rnf130 UTSW 11 50071219 missense possibly damaging 0.89
R0358:Rnf130 UTSW 11 50071282 missense probably benign 0.01
R0570:Rnf130 UTSW 11 50095876 missense possibly damaging 0.66
R0786:Rnf130 UTSW 11 50087437 missense probably damaging 1.00
R1709:Rnf130 UTSW 11 50087386 missense possibly damaging 0.80
R2312:Rnf130 UTSW 11 50087463 critical splice donor site probably null
R2972:Rnf130 UTSW 11 50093800 nonsense probably null
R4353:Rnf130 UTSW 11 50087440 missense possibly damaging 0.83
R5162:Rnf130 UTSW 11 50052895 missense probably damaging 1.00
R5236:Rnf130 UTSW 11 50095978 missense probably damaging 0.99
R5869:Rnf130 UTSW 11 50085815 splice site probably null
R6432:Rnf130 UTSW 11 50095790 nonsense probably null
R6865:Rnf130 UTSW 11 50071264 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGCACGGGAGATATTATTGC -3'
(R):5'- CGAGTGCAGGTATTACAGGGTAC -3'

Sequencing Primer
(F):5'- CACGGGAGATATTATTGCTGTCATG -3'
(R):5'- TGCAGGTATTACAGGGTACAGCAC -3'
Posted On2015-07-06