Incidental Mutation 'R4398:Eif4a1'
ID325596
Institutional Source Beutler Lab
Gene Symbol Eif4a1
Ensembl Gene ENSMUSG00000059796
Gene Nameeukaryotic translation initiation factor 4A1
Synonymsinitiation factor eIF-4A long form, Eif4
MMRRC Submission 041130-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R4398 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location69666936-69672423 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69669244 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 116 (I116M)
Ref Sequence ENSEMBL: ENSMUSP00000127034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005336] [ENSMUST00000018918] [ENSMUST00000066760] [ENSMUST00000102589] [ENSMUST00000108654] [ENSMUST00000163666]
Predicted Effect probably benign
Transcript: ENSMUST00000005336
SMART Domains Protein: ENSMUSP00000005336
Gene: ENSMUSG00000005204

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
low complexity region 42 53 N/A INTRINSIC
low complexity region 74 86 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
Pfam:Peptidase_C48 394 566 4.9e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000018918
SMART Domains Protein: ENSMUSP00000018918
Gene: ENSMUSG00000018774

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Lamp 28 326 5.6e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066760
SMART Domains Protein: ENSMUSP00000066581
Gene: ENSMUSG00000005204

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
low complexity region 42 53 N/A INTRINSIC
low complexity region 74 86 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
Pfam:Peptidase_C48 394 566 4.9e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083928
Predicted Effect probably benign
Transcript: ENSMUST00000102589
Predicted Effect probably benign
Transcript: ENSMUST00000108654
SMART Domains Protein: ENSMUSP00000104294
Gene: ENSMUSG00000018774

DomainStartEndE-ValueType
Pfam:Lamp 16 335 3.1e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122759
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123995
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127677
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128519
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129295
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133067
Predicted Effect probably benign
Transcript: ENSMUST00000134942
SMART Domains Protein: ENSMUSP00000114791
Gene: ENSMUSG00000005204

DomainStartEndE-ValueType
Pfam:Peptidase_C48 5 167 4.1e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140186
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140310
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142348
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145289
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158917
Predicted Effect possibly damaging
Transcript: ENSMUST00000163666
AA Change: I116M

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000127034
Gene: ENSMUSG00000059796
AA Change: I116M

DomainStartEndE-ValueType
DEXDc 51 249 3.61e-60 SMART
HELICc 286 367 1.04e-33 SMART
Meta Mutation Damage Score 0.8406 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 96% (53/55)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 C A 15: 94,333,695 R871L possibly damaging Het
Adcy5 G A 16: 35,268,993 C520Y probably damaging Het
AI661453 G A 17: 47,468,117 probably benign Het
Bptf T C 11: 107,110,844 K481E probably damaging Het
Cnot10 T A 9: 114,631,881 K74* probably null Het
Ctc1 C T 11: 69,022,871 P200S probably damaging Het
Dact1 T C 12: 71,317,185 Y210H probably damaging Het
Dbn1 T C 13: 55,475,381 T430A probably benign Het
Dmd A C X: 83,722,018 T657P probably benign Het
Efnb2 C T 8: 8,620,832 R256H possibly damaging Het
F730035P03Rik A T 7: 99,780,268 noncoding transcript Het
Fbn1 C T 2: 125,397,781 V329I probably benign Het
Gpr20 G A 15: 73,696,276 T88I probably benign Het
Herc1 T G 9: 66,479,453 V3783G probably benign Het
Khdc1a A G 1: 21,350,393 D79G possibly damaging Het
Klk1b16 A T 7: 44,141,427 I218F probably damaging Het
Malrd1 C T 2: 16,150,783 T2001I unknown Het
Mia3 A G 1: 183,330,878 S556P probably damaging Het
Myo3a T A 2: 22,577,842 D369E probably benign Het
Nelfa T C 5: 33,901,279 D279G possibly damaging Het
Ntrk3 A T 7: 78,250,769 C607* probably null Het
Olfr53 T C 7: 140,652,828 V283A possibly damaging Het
Pclo A T 5: 14,775,366 Q1371L probably damaging Het
Pdzd2 A T 15: 12,375,975 V1358E probably benign Het
Pgr T C 9: 8,903,749 probably null Het
Prag1 A G 8: 36,103,655 D464G probably damaging Het
Prickle4 A G 17: 47,690,531 probably benign Het
Prim2 A G 1: 33,512,111 Y309H probably damaging Het
Prkaa1 A G 15: 5,177,161 Q464R possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rint1 T A 5: 23,794,447 I78K possibly damaging Het
Rnf130 T A 11: 50,071,378 F217Y probably benign Het
Smad7 T C 18: 75,394,163 V360A probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Stag1 A G 9: 100,956,606 probably benign Het
Tlr12 T A 4: 128,616,195 D754V probably benign Het
Tmf1 G A 6: 97,178,896 P43L probably damaging Het
Togaram1 A G 12: 64,980,856 N873S probably benign Het
Tsn C T 1: 118,311,069 probably benign Het
Ubn1 A G 16: 5,064,425 K250R probably damaging Het
Vmn1r25 A T 6: 57,978,827 V159D probably damaging Het
Vmn2r89 T C 14: 51,452,094 L18P probably damaging Het
Vps8 T G 16: 21,504,466 N689K probably damaging Het
Ythdc1 T A 5: 86,815,654 D30E possibly damaging Het
Ythdc1 G T 5: 86,835,820 probably benign Het
Zfp407 G A 18: 84,562,731 Q86* probably null Het
Zfp521 C T 18: 13,846,544 E271K probably benign Het
Other mutations in Eif4a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:Eif4a1 APN 11 69669096 missense probably damaging 0.99
IGL01923:Eif4a1 APN 11 69672303 missense possibly damaging 0.81
Tour UTSW 11 69670664 missense probably damaging 0.99
R0709:Eif4a1 UTSW 11 69670252 missense probably damaging 1.00
R3407:Eif4a1 UTSW 11 69670263 missense probably damaging 1.00
R4361:Eif4a1 UTSW 11 69667464 utr 3 prime probably benign
R4896:Eif4a1 UTSW 11 69668597 intron probably benign
R4936:Eif4a1 UTSW 11 69672425 unclassified probably benign
R4941:Eif4a1 UTSW 11 69667814 intron probably benign
R6366:Eif4a1 UTSW 11 69670955 missense probably benign
R7077:Eif4a1 UTSW 11 69670664 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACACAGGTATCTCCGGTTAAGC -3'
(R):5'- AGGCTATGTTCATAATCCCAGCC -3'

Sequencing Primer
(F):5'- ACAGGTATCTCCGGTTAAGCATGTC -3'
(R):5'- TTCTAAGCCTTTGTAGAGCTGGCC -3'
Posted On2015-07-06