Incidental Mutation 'R4398:Dbn1'
ID325600
Institutional Source Beutler Lab
Gene Symbol Dbn1
Ensembl Gene ENSMUSG00000034675
Gene Namedrebrin 1
Synonymsdrebrin A, drebrin E2
MMRRC Submission 041130-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.813) question?
Stock #R4398 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location55473429-55488111 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55475381 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 430 (T430A)
Ref Sequence ENSEMBL: ENSMUSP00000105549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021950] [ENSMUST00000046533] [ENSMUST00000109921] [ENSMUST00000109923]
Predicted Effect probably benign
Transcript: ENSMUST00000021950
AA Change: T476A

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000021950
Gene: ENSMUSG00000034675
AA Change: T476A

DomainStartEndE-ValueType
ADF 8 134 2.34e-25 SMART
coiled coil region 176 256 N/A INTRINSIC
low complexity region 263 284 N/A INTRINSIC
low complexity region 331 346 N/A INTRINSIC
low complexity region 453 473 N/A INTRINSIC
low complexity region 477 498 N/A INTRINSIC
low complexity region 502 518 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
low complexity region 655 668 N/A INTRINSIC
low complexity region 697 705 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000046533
SMART Domains Protein: ENSMUSP00000046776
Gene: ENSMUSG00000034686

DomainStartEndE-ValueType
transmembrane domain 15 34 N/A INTRINSIC
low complexity region 63 131 N/A INTRINSIC
low complexity region 211 228 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109921
AA Change: T430A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000105547
Gene: ENSMUSG00000034675
AA Change: T430A

DomainStartEndE-ValueType
ADF 8 134 2.34e-25 SMART
coiled coil region 176 256 N/A INTRINSIC
low complexity region 263 284 N/A INTRINSIC
low complexity region 407 427 N/A INTRINSIC
low complexity region 431 452 N/A INTRINSIC
low complexity region 456 472 N/A INTRINSIC
low complexity region 573 591 N/A INTRINSIC
low complexity region 610 623 N/A INTRINSIC
low complexity region 652 660 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109923
AA Change: T430A

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000105549
Gene: ENSMUSG00000034675
AA Change: T430A

DomainStartEndE-ValueType
ADF 8 134 2.34e-25 SMART
coiled coil region 176 256 N/A INTRINSIC
low complexity region 263 284 N/A INTRINSIC
low complexity region 407 427 N/A INTRINSIC
low complexity region 431 452 N/A INTRINSIC
low complexity region 456 472 N/A INTRINSIC
low complexity region 573 591 N/A INTRINSIC
low complexity region 609 622 N/A INTRINSIC
low complexity region 651 659 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135705
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183653
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic actin-binding protein thought to play a role in the process of neuronal growth. It is a member of the drebrin family of proteins that are developmentally regulated in the brain. A decrease in the amount of this protein in the brain has been implicated as a possible contributing factor in the pathogenesis of memory disturbance in Alzheimer's disease. At least two alternative splice variants encoding different protein isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired cued conditioning behavior. Mice homozygous for a different knock-out allele show altered neurotransmitter receptor levels in protein complexes, abnormal dendritic spine morphology, and impaired synaptic plasticity in the hippocampus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 C A 15: 94,333,695 R871L possibly damaging Het
Adcy5 G A 16: 35,268,993 C520Y probably damaging Het
AI661453 G A 17: 47,468,117 probably benign Het
Bptf T C 11: 107,110,844 K481E probably damaging Het
Cnot10 T A 9: 114,631,881 K74* probably null Het
Ctc1 C T 11: 69,022,871 P200S probably damaging Het
Dact1 T C 12: 71,317,185 Y210H probably damaging Het
Dmd A C X: 83,722,018 T657P probably benign Het
Efnb2 C T 8: 8,620,832 R256H possibly damaging Het
Eif4a1 T C 11: 69,669,244 I116M possibly damaging Het
F730035P03Rik A T 7: 99,780,268 noncoding transcript Het
Fbn1 C T 2: 125,397,781 V329I probably benign Het
Gpr20 G A 15: 73,696,276 T88I probably benign Het
Herc1 T G 9: 66,479,453 V3783G probably benign Het
Khdc1a A G 1: 21,350,393 D79G possibly damaging Het
Klk1b16 A T 7: 44,141,427 I218F probably damaging Het
Malrd1 C T 2: 16,150,783 T2001I unknown Het
Mia3 A G 1: 183,330,878 S556P probably damaging Het
Myo3a T A 2: 22,577,842 D369E probably benign Het
Nelfa T C 5: 33,901,279 D279G possibly damaging Het
Ntrk3 A T 7: 78,250,769 C607* probably null Het
Olfr53 T C 7: 140,652,828 V283A possibly damaging Het
Pclo A T 5: 14,775,366 Q1371L probably damaging Het
Pdzd2 A T 15: 12,375,975 V1358E probably benign Het
Pgr T C 9: 8,903,749 probably null Het
Prag1 A G 8: 36,103,655 D464G probably damaging Het
Prickle4 A G 17: 47,690,531 probably benign Het
Prim2 A G 1: 33,512,111 Y309H probably damaging Het
Prkaa1 A G 15: 5,177,161 Q464R possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rint1 T A 5: 23,794,447 I78K possibly damaging Het
Rnf130 T A 11: 50,071,378 F217Y probably benign Het
Smad7 T C 18: 75,394,163 V360A probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Stag1 A G 9: 100,956,606 probably benign Het
Tlr12 T A 4: 128,616,195 D754V probably benign Het
Tmf1 G A 6: 97,178,896 P43L probably damaging Het
Togaram1 A G 12: 64,980,856 N873S probably benign Het
Tsn C T 1: 118,311,069 probably benign Het
Ubn1 A G 16: 5,064,425 K250R probably damaging Het
Vmn1r25 A T 6: 57,978,827 V159D probably damaging Het
Vmn2r89 T C 14: 51,452,094 L18P probably damaging Het
Vps8 T G 16: 21,504,466 N689K probably damaging Het
Ythdc1 T A 5: 86,815,654 D30E possibly damaging Het
Ythdc1 G T 5: 86,835,820 probably benign Het
Zfp407 G A 18: 84,562,731 Q86* probably null Het
Zfp521 C T 18: 13,846,544 E271K probably benign Het
Other mutations in Dbn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00849:Dbn1 APN 13 55482189 missense probably damaging 1.00
IGL01408:Dbn1 APN 13 55482304 splice site probably benign
IGL02123:Dbn1 APN 13 55476740 missense possibly damaging 0.82
R0026:Dbn1 UTSW 13 55477784 missense probably damaging 1.00
R0318:Dbn1 UTSW 13 55474916 missense probably damaging 1.00
R0319:Dbn1 UTSW 13 55474916 missense probably damaging 1.00
R0400:Dbn1 UTSW 13 55474916 missense probably damaging 1.00
R0417:Dbn1 UTSW 13 55474916 missense probably damaging 1.00
R0765:Dbn1 UTSW 13 55482294 missense probably damaging 1.00
R0905:Dbn1 UTSW 13 55474227 unclassified probably benign
R1695:Dbn1 UTSW 13 55476708 missense probably benign 0.01
R1844:Dbn1 UTSW 13 55481347 critical splice donor site probably null
R1997:Dbn1 UTSW 13 55482441 missense probably damaging 1.00
R2912:Dbn1 UTSW 13 55482421 missense probably damaging 0.97
R2914:Dbn1 UTSW 13 55482421 missense probably damaging 0.97
R4477:Dbn1 UTSW 13 55481561 small deletion probably benign
R4515:Dbn1 UTSW 13 55476229 missense possibly damaging 0.64
R4518:Dbn1 UTSW 13 55476229 missense possibly damaging 0.64
R4519:Dbn1 UTSW 13 55476229 missense possibly damaging 0.64
R4678:Dbn1 UTSW 13 55475258 missense probably benign
R4886:Dbn1 UTSW 13 55477542 unclassified probably benign
R6272:Dbn1 UTSW 13 55475104 missense probably benign 0.00
R6741:Dbn1 UTSW 13 55481537 critical splice donor site probably null
R7840:Dbn1 UTSW 13 55475509 missense possibly damaging 0.94
R7923:Dbn1 UTSW 13 55475509 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ATAGATCAATGAGGCTGGCAGC -3'
(R):5'- CTTCAGTGGGTGGACATGGTAC -3'

Sequencing Primer
(F):5'- CGGCAGGGGTGACGTTG -3'
(R):5'- AGGGCATCTATCCTTCCCCAAG -3'
Posted On2015-07-06