Incidental Mutation 'R4398:Vmn2r89'
ID325601
Institutional Source Beutler Lab
Gene Symbol Vmn2r89
Ensembl Gene ENSMUSG00000070448
Gene Namevomeronasal 2, receptor 89
SynonymsV2r10, V2r11
MMRRC Submission 041130-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R4398 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location51451962-51461293 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51452094 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 18 (L18P)
Ref Sequence ENSEMBL: ENSMUSP00000124256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159611] [ENSMUST00000159734] [ENSMUST00000161670] [ENSMUST00000162998]
Predicted Effect probably damaging
Transcript: ENSMUST00000159611
AA Change: L18P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124065
Gene: ENSMUSG00000070448
AA Change: L18P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 76 449 4.8e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159734
AA Change: L18P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124256
Gene: ENSMUSG00000070448
AA Change: L18P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 76 420 1.1e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161670
AA Change: L18P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124261
Gene: ENSMUSG00000070448
AA Change: L18P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162998
SMART Domains Protein: ENSMUSP00000125409
Gene: ENSMUSG00000068399

DomainStartEndE-ValueType
Pfam:Takusan 35 115 2.2e-25 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 96% (53/55)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 C A 15: 94,333,695 R871L possibly damaging Het
Adcy5 G A 16: 35,268,993 C520Y probably damaging Het
AI661453 G A 17: 47,468,117 probably benign Het
Bptf T C 11: 107,110,844 K481E probably damaging Het
Cnot10 T A 9: 114,631,881 K74* probably null Het
Ctc1 C T 11: 69,022,871 P200S probably damaging Het
Dact1 T C 12: 71,317,185 Y210H probably damaging Het
Dbn1 T C 13: 55,475,381 T430A probably benign Het
Dmd A C X: 83,722,018 T657P probably benign Het
Efnb2 C T 8: 8,620,832 R256H possibly damaging Het
Eif4a1 T C 11: 69,669,244 I116M possibly damaging Het
F730035P03Rik A T 7: 99,780,268 noncoding transcript Het
Fbn1 C T 2: 125,397,781 V329I probably benign Het
Gpr20 G A 15: 73,696,276 T88I probably benign Het
Herc1 T G 9: 66,479,453 V3783G probably benign Het
Khdc1a A G 1: 21,350,393 D79G possibly damaging Het
Klk1b16 A T 7: 44,141,427 I218F probably damaging Het
Malrd1 C T 2: 16,150,783 T2001I unknown Het
Mia3 A G 1: 183,330,878 S556P probably damaging Het
Myo3a T A 2: 22,577,842 D369E probably benign Het
Nelfa T C 5: 33,901,279 D279G possibly damaging Het
Ntrk3 A T 7: 78,250,769 C607* probably null Het
Olfr53 T C 7: 140,652,828 V283A possibly damaging Het
Pclo A T 5: 14,775,366 Q1371L probably damaging Het
Pdzd2 A T 15: 12,375,975 V1358E probably benign Het
Pgr T C 9: 8,903,749 probably null Het
Prag1 A G 8: 36,103,655 D464G probably damaging Het
Prickle4 A G 17: 47,690,531 probably benign Het
Prim2 A G 1: 33,512,111 Y309H probably damaging Het
Prkaa1 A G 15: 5,177,161 Q464R possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rint1 T A 5: 23,794,447 I78K possibly damaging Het
Rnf130 T A 11: 50,071,378 F217Y probably benign Het
Smad7 T C 18: 75,394,163 V360A probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Stag1 A G 9: 100,956,606 probably benign Het
Tlr12 T A 4: 128,616,195 D754V probably benign Het
Tmf1 G A 6: 97,178,896 P43L probably damaging Het
Togaram1 A G 12: 64,980,856 N873S probably benign Het
Tsn C T 1: 118,311,069 probably benign Het
Ubn1 A G 16: 5,064,425 K250R probably damaging Het
Vmn1r25 A T 6: 57,978,827 V159D probably damaging Het
Vps8 T G 16: 21,504,466 N689K probably damaging Het
Ythdc1 T A 5: 86,815,654 D30E possibly damaging Het
Ythdc1 G T 5: 86,835,820 probably benign Het
Zfp407 G A 18: 84,562,731 Q86* probably null Het
Zfp521 C T 18: 13,846,544 E271K probably benign Het
Other mutations in Vmn2r89
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Vmn2r89 APN 14 51454965 missense probably damaging 1.00
IGL00990:Vmn2r89 APN 14 51455971 missense probably benign 0.14
IGL00990:Vmn2r89 APN 14 51457493 missense probably benign
IGL01991:Vmn2r89 APN 14 51452219 missense probably benign 0.00
IGL03073:Vmn2r89 APN 14 51456071 missense possibly damaging 0.95
IGL03085:Vmn2r89 APN 14 51452158 missense probably damaging 0.99
IGL03278:Vmn2r89 APN 14 51455100 missense probably damaging 0.99
R0115:Vmn2r89 UTSW 14 51456120 missense probably damaging 1.00
R0127:Vmn2r89 UTSW 14 51455703 missense probably damaging 0.98
R0391:Vmn2r89 UTSW 14 51455978 missense probably damaging 0.99
R0481:Vmn2r89 UTSW 14 51456120 missense probably damaging 1.00
R0538:Vmn2r89 UTSW 14 51457591 splice site probably null
R1210:Vmn2r89 UTSW 14 51454970 missense probably benign 0.01
R1332:Vmn2r89 UTSW 14 51455102 missense probably benign 0.00
R1660:Vmn2r89 UTSW 14 51456236 missense possibly damaging 0.48
R1959:Vmn2r89 UTSW 14 51457440 missense probably benign 0.22
R2876:Vmn2r89 UTSW 14 51455084 missense possibly damaging 0.47
R3410:Vmn2r89 UTSW 14 51456171 missense probably damaging 0.98
R4026:Vmn2r89 UTSW 14 51452043 start codon destroyed probably null 1.00
R4700:Vmn2r89 UTSW 14 51457485 missense probably damaging 1.00
R4714:Vmn2r89 UTSW 14 51452231 missense probably damaging 0.97
R5162:Vmn2r89 UTSW 14 51456163 missense possibly damaging 0.88
R5294:Vmn2r89 UTSW 14 51455113 missense probably benign 0.00
R5811:Vmn2r89 UTSW 14 51456108 missense probably benign 0.12
R6087:Vmn2r89 UTSW 14 51457576 splice site probably null
R6229:Vmn2r89 UTSW 14 51455721 missense probably benign 0.05
R6246:Vmn2r89 UTSW 14 51456046 missense probably damaging 1.00
R6572:Vmn2r89 UTSW 14 51455993 missense probably damaging 1.00
R7351:Vmn2r89 UTSW 14 51456282 missense probably benign 0.30
R7683:Vmn2r89 UTSW 14 51455194 missense probably benign
R7974:Vmn2r89 UTSW 14 51456002 missense probably damaging 1.00
R8047:Vmn2r89 UTSW 14 51455092 missense probably benign 0.05
R8093:Vmn2r89 UTSW 14 51456242 missense probably benign 0.00
R8348:Vmn2r89 UTSW 14 51455091 missense possibly damaging 0.90
R8723:Vmn2r89 UTSW 14 51456453 missense probably benign
R8737:Vmn2r89 UTSW 14 51456265 missense probably damaging 1.00
X0019:Vmn2r89 UTSW 14 51456415 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CCCTATGTATCTAGGGAGCATGAC -3'
(R):5'- CTCACTAATGACATTGACACAGG -3'

Sequencing Primer
(F):5'- TATGTATCTAGGGAGCATGACATAGG -3'
(R):5'- CCCAAAGGTAAAAATGACATTC -3'
Posted On2015-07-06