Incidental Mutation 'R4398:Prkaa1'
ID325602
Institutional Source Beutler Lab
Gene Symbol Prkaa1
Ensembl Gene ENSMUSG00000050697
Gene Nameprotein kinase, AMP-activated, alpha 1 catalytic subunit
SynonymsC130083N04Rik, AMPKalpha1
MMRRC Submission 041130-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4398 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location5143861-5181899 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5177161 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 464 (Q464R)
Ref Sequence ENSEMBL: ENSMUSP00000063166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051186] [ENSMUST00000228218]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051186
AA Change: Q464R

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000063166
Gene: ENSMUSG00000050697
AA Change: Q464R

DomainStartEndE-ValueType
S_TKc 27 279 2.23e-103 SMART
low complexity region 305 318 N/A INTRINSIC
Pfam:AdenylateSensor 406 503 1.3e-15 PFAM
low complexity region 516 535 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150079
Predicted Effect probably benign
Transcript: ENSMUST00000228218
AA Change: Q455R

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.1975 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ser/thr protein kinase family. It is the catalytic subunit of the 5'-prime-AMP-activated protein kinase (AMPK). AMPK is a cellular energy sensor conserved in all eukaryotic cells. The kinase activity of AMPK is activated by the stimuli that increase the cellular AMP/ATP ratio. AMPK regulates the activities of a number of key metabolic enzymes through phosphorylation. It protects cells from stresses that cause ATP depletion by switching off ATP-consuming biosynthetic pathways. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased muscle cell glucose uptake. Mice homozygous for a different knock-out allele exhibit anemia, reticulocytosis, splenomegaly, increased erythrocyte turnover, and elevated plasma erythropoietin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 C A 15: 94,333,695 R871L possibly damaging Het
Adcy5 G A 16: 35,268,993 C520Y probably damaging Het
AI661453 G A 17: 47,468,117 probably benign Het
Bptf T C 11: 107,110,844 K481E probably damaging Het
Cnot10 T A 9: 114,631,881 K74* probably null Het
Ctc1 C T 11: 69,022,871 P200S probably damaging Het
Dact1 T C 12: 71,317,185 Y210H probably damaging Het
Dbn1 T C 13: 55,475,381 T430A probably benign Het
Dmd A C X: 83,722,018 T657P probably benign Het
Efnb2 C T 8: 8,620,832 R256H possibly damaging Het
Eif4a1 T C 11: 69,669,244 I116M possibly damaging Het
F730035P03Rik A T 7: 99,780,268 noncoding transcript Het
Fbn1 C T 2: 125,397,781 V329I probably benign Het
Gpr20 G A 15: 73,696,276 T88I probably benign Het
Herc1 T G 9: 66,479,453 V3783G probably benign Het
Khdc1a A G 1: 21,350,393 D79G possibly damaging Het
Klk1b16 A T 7: 44,141,427 I218F probably damaging Het
Malrd1 C T 2: 16,150,783 T2001I unknown Het
Mia3 A G 1: 183,330,878 S556P probably damaging Het
Myo3a T A 2: 22,577,842 D369E probably benign Het
Nelfa T C 5: 33,901,279 D279G possibly damaging Het
Ntrk3 A T 7: 78,250,769 C607* probably null Het
Olfr53 T C 7: 140,652,828 V283A possibly damaging Het
Pclo A T 5: 14,775,366 Q1371L probably damaging Het
Pdzd2 A T 15: 12,375,975 V1358E probably benign Het
Pgr T C 9: 8,903,749 probably null Het
Prag1 A G 8: 36,103,655 D464G probably damaging Het
Prickle4 A G 17: 47,690,531 probably benign Het
Prim2 A G 1: 33,512,111 Y309H probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rint1 T A 5: 23,794,447 I78K possibly damaging Het
Rnf130 T A 11: 50,071,378 F217Y probably benign Het
Smad7 T C 18: 75,394,163 V360A probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Stag1 A G 9: 100,956,606 probably benign Het
Tlr12 T A 4: 128,616,195 D754V probably benign Het
Tmf1 G A 6: 97,178,896 P43L probably damaging Het
Togaram1 A G 12: 64,980,856 N873S probably benign Het
Tsn C T 1: 118,311,069 probably benign Het
Ubn1 A G 16: 5,064,425 K250R probably damaging Het
Vmn1r25 A T 6: 57,978,827 V159D probably damaging Het
Vmn2r89 T C 14: 51,452,094 L18P probably damaging Het
Vps8 T G 16: 21,504,466 N689K probably damaging Het
Ythdc1 T A 5: 86,815,654 D30E possibly damaging Het
Ythdc1 G T 5: 86,835,820 probably benign Het
Zfp407 G A 18: 84,562,731 Q86* probably null Het
Zfp521 C T 18: 13,846,544 E271K probably benign Het
Other mutations in Prkaa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Prkaa1 APN 15 5174318 missense probably damaging 1.00
IGL01797:Prkaa1 APN 15 5168706 missense probably damaging 1.00
IGL02442:Prkaa1 APN 15 5176888 missense probably damaging 1.00
IGL02890:Prkaa1 APN 15 5177086 missense possibly damaging 0.91
IGL03146:Prkaa1 APN 15 5168641 missense probably damaging 0.99
IGL03396:Prkaa1 APN 15 5176650 missense probably damaging 1.00
pressor UTSW 15 5176956 missense probably damaging 1.00
R1439:Prkaa1 UTSW 15 5164744 missense probably damaging 0.99
R1466:Prkaa1 UTSW 15 5178798 missense probably benign
R1466:Prkaa1 UTSW 15 5178798 missense probably benign
R1804:Prkaa1 UTSW 15 5178778 missense probably benign 0.41
R1807:Prkaa1 UTSW 15 5143954 missense probably damaging 1.00
R4381:Prkaa1 UTSW 15 5176808 missense probably benign
R4579:Prkaa1 UTSW 15 5160601 critical splice acceptor site probably null
R4689:Prkaa1 UTSW 15 5178696 missense probably benign
R4832:Prkaa1 UTSW 15 5160620 missense probably damaging 0.96
R4874:Prkaa1 UTSW 15 5174357 missense probably benign 0.16
R4876:Prkaa1 UTSW 15 5174405 missense probably benign 0.44
R5074:Prkaa1 UTSW 15 5176911 missense possibly damaging 0.82
R5260:Prkaa1 UTSW 15 5160668 missense probably damaging 1.00
R5563:Prkaa1 UTSW 15 5169956 missense probably damaging 1.00
R5706:Prkaa1 UTSW 15 5174342 missense probably benign 0.01
R6363:Prkaa1 UTSW 15 5176956 missense probably damaging 1.00
R6825:Prkaa1 UTSW 15 5143950 missense possibly damaging 0.91
R7090:Prkaa1 UTSW 15 5177130 missense probably benign
R7921:Prkaa1 UTSW 15 5177151 missense probably damaging 1.00
R7989:Prkaa1 UTSW 15 5176685 missense probably damaging 1.00
R8289:Prkaa1 UTSW 15 5177082 missense possibly damaging 0.88
R8314:Prkaa1 UTSW 15 5178873 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGAGCAATCAAGCAGTTGGATTATG -3'
(R):5'- GGCGCCATATGAAGCTTACTAC -3'

Sequencing Primer
(F):5'- TAAGAAGGCAAGTGCTCTCTCTG -3'
(R):5'- GCGCCATATGAAGCTTACTACTTTGC -3'
Posted On2015-07-06