Incidental Mutation 'R4398:Ubn1'
ID325606
Institutional Source Beutler Lab
Gene Symbol Ubn1
Ensembl Gene ENSMUSG00000039473
Gene Nameubinuclein 1
Synonyms1110029L11Rik, 2610108L02Rik
MMRRC Submission 041130-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.707) question?
Stock #R4398 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location5050057-5086289 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5064425 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 250 (K250R)
Ref Sequence ENSEMBL: ENSMUSP00000155223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052449] [ENSMUST00000229126] [ENSMUST00000229570] [ENSMUST00000230703]
Predicted Effect probably damaging
Transcript: ENSMUST00000052449
AA Change: K250R

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000061843
Gene: ENSMUSG00000039473
AA Change: K250R

DomainStartEndE-ValueType
Pfam:HUN 117 168 1.4e-22 PFAM
low complexity region 181 224 N/A INTRINSIC
low complexity region 232 238 N/A INTRINSIC
low complexity region 250 267 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
Pfam:UBN_AB 353 573 2.4e-80 PFAM
low complexity region 792 804 N/A INTRINSIC
low complexity region 856 882 N/A INTRINSIC
low complexity region 905 934 N/A INTRINSIC
low complexity region 970 984 N/A INTRINSIC
low complexity region 996 1006 N/A INTRINSIC
low complexity region 1016 1034 N/A INTRINSIC
low complexity region 1084 1098 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229060
Predicted Effect probably damaging
Transcript: ENSMUST00000229126
AA Change: K250R

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000229570
AA Change: K7R

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably damaging
Transcript: ENSMUST00000230703
AA Change: K250R

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Meta Mutation Damage Score 0.0605 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cellular senescence is a hallmark of tumor suppression and tissue aging. Senescent cells contain domains of heterochromatin, called senescence-associated heterochromatin foci (SAHF), that repress proliferation-promoting genes. The protein encoded by this gene binds to proliferation-promoting genes and is required for SAHF formation, enhancing methylation of histone H3. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 C A 15: 94,333,695 R871L possibly damaging Het
Adcy5 G A 16: 35,268,993 C520Y probably damaging Het
AI661453 G A 17: 47,468,117 probably benign Het
Bptf T C 11: 107,110,844 K481E probably damaging Het
Cnot10 T A 9: 114,631,881 K74* probably null Het
Ctc1 C T 11: 69,022,871 P200S probably damaging Het
Dact1 T C 12: 71,317,185 Y210H probably damaging Het
Dbn1 T C 13: 55,475,381 T430A probably benign Het
Dmd A C X: 83,722,018 T657P probably benign Het
Efnb2 C T 8: 8,620,832 R256H possibly damaging Het
Eif4a1 T C 11: 69,669,244 I116M possibly damaging Het
F730035P03Rik A T 7: 99,780,268 noncoding transcript Het
Fbn1 C T 2: 125,397,781 V329I probably benign Het
Gpr20 G A 15: 73,696,276 T88I probably benign Het
Herc1 T G 9: 66,479,453 V3783G probably benign Het
Khdc1a A G 1: 21,350,393 D79G possibly damaging Het
Klk1b16 A T 7: 44,141,427 I218F probably damaging Het
Malrd1 C T 2: 16,150,783 T2001I unknown Het
Mia3 A G 1: 183,330,878 S556P probably damaging Het
Myo3a T A 2: 22,577,842 D369E probably benign Het
Nelfa T C 5: 33,901,279 D279G possibly damaging Het
Ntrk3 A T 7: 78,250,769 C607* probably null Het
Olfr53 T C 7: 140,652,828 V283A possibly damaging Het
Pclo A T 5: 14,775,366 Q1371L probably damaging Het
Pdzd2 A T 15: 12,375,975 V1358E probably benign Het
Pgr T C 9: 8,903,749 probably null Het
Prag1 A G 8: 36,103,655 D464G probably damaging Het
Prickle4 A G 17: 47,690,531 probably benign Het
Prim2 A G 1: 33,512,111 Y309H probably damaging Het
Prkaa1 A G 15: 5,177,161 Q464R possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rint1 T A 5: 23,794,447 I78K possibly damaging Het
Rnf130 T A 11: 50,071,378 F217Y probably benign Het
Smad7 T C 18: 75,394,163 V360A probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Stag1 A G 9: 100,956,606 probably benign Het
Tlr12 T A 4: 128,616,195 D754V probably benign Het
Tmf1 G A 6: 97,178,896 P43L probably damaging Het
Togaram1 A G 12: 64,980,856 N873S probably benign Het
Tsn C T 1: 118,311,069 probably benign Het
Vmn1r25 A T 6: 57,978,827 V159D probably damaging Het
Vmn2r89 T C 14: 51,452,094 L18P probably damaging Het
Vps8 T G 16: 21,504,466 N689K probably damaging Het
Ythdc1 T A 5: 86,815,654 D30E possibly damaging Het
Ythdc1 G T 5: 86,835,820 probably benign Het
Zfp407 G A 18: 84,562,731 Q86* probably null Het
Zfp521 C T 18: 13,846,544 E271K probably benign Het
Other mutations in Ubn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Ubn1 APN 16 5081914 missense probably benign 0.00
IGL01726:Ubn1 APN 16 5073470 critical splice donor site probably null
IGL01744:Ubn1 APN 16 5072059 missense probably damaging 1.00
IGL01777:Ubn1 APN 16 5072149 missense possibly damaging 0.46
IGL02110:Ubn1 APN 16 5081890 splice site probably benign
IGL02667:Ubn1 APN 16 5062599 missense probably damaging 1.00
IGL03345:Ubn1 APN 16 5081964 missense probably damaging 0.98
R0201:Ubn1 UTSW 16 5064614 missense probably damaging 1.00
R0437:Ubn1 UTSW 16 5072184 critical splice donor site probably benign
R0514:Ubn1 UTSW 16 5073071 missense probably damaging 1.00
R0550:Ubn1 UTSW 16 5062620 unclassified probably null
R0919:Ubn1 UTSW 16 5064391 missense probably damaging 1.00
R1183:Ubn1 UTSW 16 5064542 missense probably damaging 1.00
R1339:Ubn1 UTSW 16 5055335 missense probably damaging 0.99
R1440:Ubn1 UTSW 16 5077294 missense probably damaging 1.00
R1836:Ubn1 UTSW 16 5077391 missense probably benign
R2024:Ubn1 UTSW 16 5064623 missense probably damaging 1.00
R2026:Ubn1 UTSW 16 5064650 missense probably damaging 1.00
R2105:Ubn1 UTSW 16 5077224 nonsense probably null
R2896:Ubn1 UTSW 16 5055219 missense possibly damaging 0.60
R3418:Ubn1 UTSW 16 5074379 splice site probably benign
R3721:Ubn1 UTSW 16 5073378 missense possibly damaging 0.59
R4033:Ubn1 UTSW 16 5064611 missense probably damaging 1.00
R4547:Ubn1 UTSW 16 5072092 missense probably damaging 1.00
R4646:Ubn1 UTSW 16 5077987 missense probably damaging 0.99
R4870:Ubn1 UTSW 16 5077313 missense probably damaging 1.00
R5018:Ubn1 UTSW 16 5063725 missense probably damaging 1.00
R5220:Ubn1 UTSW 16 5077954 missense probably benign 0.02
R5394:Ubn1 UTSW 16 5074369 missense possibly damaging 0.51
R6217:Ubn1 UTSW 16 5077232 missense probably damaging 1.00
R6372:Ubn1 UTSW 16 5081638 missense possibly damaging 0.84
R6418:Ubn1 UTSW 16 5081927 missense probably benign
R6823:Ubn1 UTSW 16 5064547 missense probably damaging 1.00
R7028:Ubn1 UTSW 16 5055324 missense probably damaging 1.00
R7203:Ubn1 UTSW 16 5077216 missense possibly damaging 0.57
R7498:Ubn1 UTSW 16 5077105 missense probably damaging 0.99
R7596:Ubn1 UTSW 16 5081558 missense probably benign 0.25
RF018:Ubn1 UTSW 16 5064392 missense probably damaging 1.00
X0067:Ubn1 UTSW 16 5055338 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GTTCTCTTTGCCAAAAGGATGG -3'
(R):5'- TCAGAGAGTCCATGGCAGTG -3'

Sequencing Primer
(F):5'- CTTTGCCAAAAGGATGGAGGCATG -3'
(R):5'- CATGGCAGTGGCAGCTTG -3'
Posted On2015-07-06