Incidental Mutation 'R4398:AI661453'
ID325609
Institutional Source Beutler Lab
Gene Symbol AI661453
Ensembl Gene ENSMUSG00000034382
Gene Nameexpressed sequence AI661453
Synonyms
MMRRC Submission 041130-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R4398 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location47436615-47470638 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to A at 47468117 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000045345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037701] [ENSMUST00000150819]
Predicted Effect probably benign
Transcript: ENSMUST00000037701
SMART Domains Protein: ENSMUSP00000045345
Gene: ENSMUSG00000034382

DomainStartEndE-ValueType
low complexity region 140 151 N/A INTRINSIC
low complexity region 157 180 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000150819
AA Change: A923T
SMART Domains Protein: ENSMUSP00000120133
Gene: ENSMUSG00000034382
AA Change: A923T

DomainStartEndE-ValueType
low complexity region 140 151 N/A INTRINSIC
low complexity region 157 237 N/A INTRINSIC
low complexity region 294 312 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
low complexity region 354 364 N/A INTRINSIC
low complexity region 384 423 N/A INTRINSIC
low complexity region 429 444 N/A INTRINSIC
low complexity region 522 535 N/A INTRINSIC
low complexity region 612 627 N/A INTRINSIC
internal_repeat_1 628 654 6.24e-9 PROSPERO
low complexity region 656 671 N/A INTRINSIC
internal_repeat_1 688 714 6.24e-9 PROSPERO
low complexity region 853 863 N/A INTRINSIC
low complexity region 976 1016 N/A INTRINSIC
low complexity region 1147 1154 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 96% (53/55)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 C A 15: 94,333,695 R871L possibly damaging Het
Adcy5 G A 16: 35,268,993 C520Y probably damaging Het
Bptf T C 11: 107,110,844 K481E probably damaging Het
Cnot10 T A 9: 114,631,881 K74* probably null Het
Ctc1 C T 11: 69,022,871 P200S probably damaging Het
Dact1 T C 12: 71,317,185 Y210H probably damaging Het
Dbn1 T C 13: 55,475,381 T430A probably benign Het
Dmd A C X: 83,722,018 T657P probably benign Het
Efnb2 C T 8: 8,620,832 R256H possibly damaging Het
Eif4a1 T C 11: 69,669,244 I116M possibly damaging Het
F730035P03Rik A T 7: 99,780,268 noncoding transcript Het
Fbn1 C T 2: 125,397,781 V329I probably benign Het
Gpr20 G A 15: 73,696,276 T88I probably benign Het
Herc1 T G 9: 66,479,453 V3783G probably benign Het
Khdc1a A G 1: 21,350,393 D79G possibly damaging Het
Klk1b16 A T 7: 44,141,427 I218F probably damaging Het
Malrd1 C T 2: 16,150,783 T2001I unknown Het
Mia3 A G 1: 183,330,878 S556P probably damaging Het
Myo3a T A 2: 22,577,842 D369E probably benign Het
Nelfa T C 5: 33,901,279 D279G possibly damaging Het
Ntrk3 A T 7: 78,250,769 C607* probably null Het
Olfr53 T C 7: 140,652,828 V283A possibly damaging Het
Pclo A T 5: 14,775,366 Q1371L probably damaging Het
Pdzd2 A T 15: 12,375,975 V1358E probably benign Het
Pgr T C 9: 8,903,749 probably null Het
Prag1 A G 8: 36,103,655 D464G probably damaging Het
Prickle4 A G 17: 47,690,531 probably benign Het
Prim2 A G 1: 33,512,111 Y309H probably damaging Het
Prkaa1 A G 15: 5,177,161 Q464R possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rint1 T A 5: 23,794,447 I78K possibly damaging Het
Rnf130 T A 11: 50,071,378 F217Y probably benign Het
Smad7 T C 18: 75,394,163 V360A probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Stag1 A G 9: 100,956,606 probably benign Het
Tlr12 T A 4: 128,616,195 D754V probably benign Het
Tmf1 G A 6: 97,178,896 P43L probably damaging Het
Togaram1 A G 12: 64,980,856 N873S probably benign Het
Tsn C T 1: 118,311,069 probably benign Het
Ubn1 A G 16: 5,064,425 K250R probably damaging Het
Vmn1r25 A T 6: 57,978,827 V159D probably damaging Het
Vmn2r89 T C 14: 51,452,094 L18P probably damaging Het
Vps8 T G 16: 21,504,466 N689K probably damaging Het
Ythdc1 T A 5: 86,815,654 D30E possibly damaging Het
Ythdc1 G T 5: 86,835,820 probably benign Het
Zfp407 G A 18: 84,562,731 Q86* probably null Het
Zfp521 C T 18: 13,846,544 E271K probably benign Het
Other mutations in AI661453
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01758:AI661453 APN 17 47466623 intron probably benign
IGL01995:AI661453 APN 17 47468517 intron probably benign
IGL02171:AI661453 APN 17 47466996 intron probably benign
IGL02411:AI661453 APN 17 47467338 intron probably benign
IGL02422:AI661453 APN 17 47467092 intron probably benign
IGL02609:AI661453 APN 17 47468372 intron probably benign
IGL02888:AI661453 APN 17 47467404 intron probably benign
IGL03024:AI661453 APN 17 47446588 missense probably damaging 1.00
R0077:AI661453 UTSW 17 47469362 intron probably benign
R0092:AI661453 UTSW 17 47467515 intron probably benign
R0144:AI661453 UTSW 17 47469299 intron probably benign
R0330:AI661453 UTSW 17 47446646 missense probably damaging 1.00
R0590:AI661453 UTSW 17 47467074 intron probably benign
R0839:AI661453 UTSW 17 47436827 missense probably null 0.97
R1350:AI661453 UTSW 17 47467928 nonsense probably null
R1436:AI661453 UTSW 17 47466702 intron probably benign
R1439:AI661453 UTSW 17 47466662 intron probably benign
R1643:AI661453 UTSW 17 47467866 intron probably benign
R1994:AI661453 UTSW 17 47467034 intron probably benign
R2145:AI661453 UTSW 17 47466098 intron probably benign
R2986:AI661453 UTSW 17 47466772 nonsense probably null
R4809:AI661453 UTSW 17 47467187 intron probably benign
R4913:AI661453 UTSW 17 47468555 nonsense probably null
R4972:AI661453 UTSW 17 47466399 intron probably benign
R6430:AI661453 UTSW 17 47466797 intron probably benign
R6687:AI661453 UTSW 17 47467002 intron probably benign
R7494:AI661453 UTSW 17 47468180 missense unknown
R7598:AI661453 UTSW 17 47466120 missense unknown
R7635:AI661453 UTSW 17 47467751 missense unknown
R7753:AI661453 UTSW 17 47467514 nonsense probably null
R8022:AI661453 UTSW 17 47466236 missense unknown
Predicted Primers PCR Primer
(F):5'- AGCCAGCTGATCAACTCCTC -3'
(R):5'- GATCGTTGCTGAACTCTGGC -3'

Sequencing Primer
(F):5'- TCCTTGCAGCCAGACAGAG -3'
(R):5'- GGAATGATATCAAAGCTGAACTCCTC -3'
Posted On2015-07-06