Incidental Mutation 'R4398:Zfp521'
ID325611
Institutional Source Beutler Lab
Gene Symbol Zfp521
Ensembl Gene ENSMUSG00000024420
Gene Namezinc finger protein 521
SynonymsB930086A16Rik, Evi3
MMRRC Submission 041130-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.934) question?
Stock #R4398 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location13687013-13972733 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 13846544 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 271 (E271K)
Ref Sequence ENSEMBL: ENSMUSP00000025288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025288]
Predicted Effect probably benign
Transcript: ENSMUST00000025288
AA Change: E271K

PolyPhen 2 Score 0.262 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000025288
Gene: ENSMUSG00000024420
AA Change: E271K

DomainStartEndE-ValueType
ZnF_C2H2 47 68 3.47e1 SMART
low complexity region 82 100 N/A INTRINSIC
low complexity region 102 113 N/A INTRINSIC
ZnF_C2H2 118 140 3.89e-3 SMART
ZnF_C2H2 146 168 1.33e-1 SMART
ZnF_C2H2 174 196 1.38e-3 SMART
ZnF_C2H2 202 224 2.36e-2 SMART
ZnF_C2H2 246 269 6.57e-1 SMART
ZnF_C2H2 281 304 3.52e-1 SMART
ZnF_C2H2 310 332 1.76e-1 SMART
low complexity region 345 358 N/A INTRINSIC
ZnF_C2H2 405 429 4.34e-1 SMART
ZnF_C2H2 437 460 6.23e-2 SMART
ZnF_C2H2 477 500 8.94e-3 SMART
ZnF_C2H2 513 536 5.42e-2 SMART
ZnF_C2H2 560 585 1.86e0 SMART
ZnF_C2H2 634 656 1.12e-3 SMART
ZnF_C2H2 664 686 2.12e-4 SMART
ZnF_C2H2 694 717 6.42e-4 SMART
ZnF_C2H2 722 745 7.78e-3 SMART
ZnF_C2H2 752 775 6.32e-3 SMART
ZnF_C2H2 783 805 2.05e-2 SMART
ZnF_C2H2 809 832 4.72e-2 SMART
ZnF_C2H2 886 909 1.86e0 SMART
ZnF_C2H2 930 952 3.04e-5 SMART
ZnF_C2H2 959 981 6.42e-4 SMART
ZnF_C2H2 988 1010 7.49e0 SMART
ZnF_C2H2 1020 1042 4.99e1 SMART
Blast:RING 1067 1098 1e-9 BLAST
low complexity region 1099 1119 N/A INTRINSIC
ZnF_C2H2 1138 1161 1.79e-2 SMART
ZnF_C2H2 1195 1217 2.53e-2 SMART
ZnF_C2H2 1225 1247 2.32e-1 SMART
ZnF_C2H2 1256 1279 2.91e-2 SMART
ZnF_C2H2 1286 1309 5.72e-1 SMART
Meta Mutation Damage Score 0.0840 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 96% (53/55)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit postnatal growth retardation, behavioral anomalies including hyperlocomotion, lower anxiety, higher impulsivity and impaired learning, abnormal formation of the neuronal cell layers of the dentate gyrus in the hippocampus, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 C A 15: 94,333,695 R871L possibly damaging Het
Adcy5 G A 16: 35,268,993 C520Y probably damaging Het
AI661453 G A 17: 47,468,117 probably benign Het
Bptf T C 11: 107,110,844 K481E probably damaging Het
Cnot10 T A 9: 114,631,881 K74* probably null Het
Ctc1 C T 11: 69,022,871 P200S probably damaging Het
Dact1 T C 12: 71,317,185 Y210H probably damaging Het
Dbn1 T C 13: 55,475,381 T430A probably benign Het
Dmd A C X: 83,722,018 T657P probably benign Het
Efnb2 C T 8: 8,620,832 R256H possibly damaging Het
Eif4a1 T C 11: 69,669,244 I116M possibly damaging Het
F730035P03Rik A T 7: 99,780,268 noncoding transcript Het
Fbn1 C T 2: 125,397,781 V329I probably benign Het
Gpr20 G A 15: 73,696,276 T88I probably benign Het
Herc1 T G 9: 66,479,453 V3783G probably benign Het
Khdc1a A G 1: 21,350,393 D79G possibly damaging Het
Klk1b16 A T 7: 44,141,427 I218F probably damaging Het
Malrd1 C T 2: 16,150,783 T2001I unknown Het
Mia3 A G 1: 183,330,878 S556P probably damaging Het
Myo3a T A 2: 22,577,842 D369E probably benign Het
Nelfa T C 5: 33,901,279 D279G possibly damaging Het
Ntrk3 A T 7: 78,250,769 C607* probably null Het
Olfr53 T C 7: 140,652,828 V283A possibly damaging Het
Pclo A T 5: 14,775,366 Q1371L probably damaging Het
Pdzd2 A T 15: 12,375,975 V1358E probably benign Het
Pgr T C 9: 8,903,749 probably null Het
Prag1 A G 8: 36,103,655 D464G probably damaging Het
Prickle4 A G 17: 47,690,531 probably benign Het
Prim2 A G 1: 33,512,111 Y309H probably damaging Het
Prkaa1 A G 15: 5,177,161 Q464R possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rint1 T A 5: 23,794,447 I78K possibly damaging Het
Rnf130 T A 11: 50,071,378 F217Y probably benign Het
Smad7 T C 18: 75,394,163 V360A probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Stag1 A G 9: 100,956,606 probably benign Het
Tlr12 T A 4: 128,616,195 D754V probably benign Het
Tmf1 G A 6: 97,178,896 P43L probably damaging Het
Togaram1 A G 12: 64,980,856 N873S probably benign Het
Tsn C T 1: 118,311,069 probably benign Het
Ubn1 A G 16: 5,064,425 K250R probably damaging Het
Vmn1r25 A T 6: 57,978,827 V159D probably damaging Het
Vmn2r89 T C 14: 51,452,094 L18P probably damaging Het
Vps8 T G 16: 21,504,466 N689K probably damaging Het
Ythdc1 T A 5: 86,815,654 D30E possibly damaging Het
Ythdc1 G T 5: 86,835,820 probably benign Het
Zfp407 G A 18: 84,562,731 Q86* probably null Het
Other mutations in Zfp521
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Zfp521 APN 18 13846502 missense probably benign 0.15
IGL00499:Zfp521 APN 18 13939120 missense probably benign 0.25
IGL01291:Zfp521 APN 18 13817246 missense probably damaging 1.00
IGL01335:Zfp521 APN 18 13844719 missense probably benign 0.31
IGL01384:Zfp521 APN 18 13843923 missense probably benign 0.26
IGL01520:Zfp521 APN 18 13938988 missense possibly damaging 0.92
IGL02248:Zfp521 APN 18 13844246 missense possibly damaging 0.93
IGL02640:Zfp521 APN 18 13844930 missense probably benign 0.00
ANU05:Zfp521 UTSW 18 13817246 missense probably damaging 1.00
R0113:Zfp521 UTSW 18 13845091 missense probably damaging 1.00
R0197:Zfp521 UTSW 18 13845062 missense probably benign 0.00
R0457:Zfp521 UTSW 18 13844840 missense probably benign
R0494:Zfp521 UTSW 18 13845268 missense probably damaging 1.00
R0494:Zfp521 UTSW 18 13846870 missense probably damaging 1.00
R0883:Zfp521 UTSW 18 13845062 missense probably benign 0.00
R2133:Zfp521 UTSW 18 13844705 missense possibly damaging 0.88
R2263:Zfp521 UTSW 18 13846240 missense possibly damaging 0.89
R3699:Zfp521 UTSW 18 13846273 nonsense probably null
R3760:Zfp521 UTSW 18 13844629 missense possibly damaging 0.93
R3851:Zfp521 UTSW 18 13717751 splice site probably benign
R3950:Zfp521 UTSW 18 13846346 missense probably damaging 0.99
R4583:Zfp521 UTSW 18 13844330 missense probably benign 0.19
R4688:Zfp521 UTSW 18 13844590 missense probably damaging 1.00
R4688:Zfp521 UTSW 18 13844591 nonsense probably null
R4698:Zfp521 UTSW 18 13845603 missense probably damaging 0.96
R4738:Zfp521 UTSW 18 13844054 missense possibly damaging 0.50
R5031:Zfp521 UTSW 18 13844273 missense possibly damaging 0.68
R5137:Zfp521 UTSW 18 13845448 missense probably damaging 1.00
R5257:Zfp521 UTSW 18 13846978 missense probably damaging 1.00
R5420:Zfp521 UTSW 18 13844087 missense probably damaging 1.00
R5917:Zfp521 UTSW 18 13845555 missense probably damaging 0.98
R5995:Zfp521 UTSW 18 13717624 missense probably damaging 1.00
R6088:Zfp521 UTSW 18 13846109 missense possibly damaging 0.47
R6150:Zfp521 UTSW 18 13844078 missense probably damaging 1.00
R6261:Zfp521 UTSW 18 13844627 missense probably damaging 1.00
R7649:Zfp521 UTSW 18 13844356 missense probably damaging 1.00
R7662:Zfp521 UTSW 18 13844116 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAACCCACAGTGACCAGG -3'
(R):5'- GCTCCTTGCACGGACATATG -3'

Sequencing Primer
(F):5'- ACTGTCCATGTGGCTATACAG -3'
(R):5'- TGCACGGACATATGCAGGTTC -3'
Posted On2015-07-06