Incidental Mutation 'R4398:Smad7'
ID325612
Institutional Source Beutler Lab
Gene Symbol Smad7
Ensembl Gene ENSMUSG00000025880
Gene NameSMAD family member 7
SynonymsMadh7
MMRRC Submission 041130-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.878) question?
Stock #R4398 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location75367529-75395935 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75394163 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 360 (V360A)
Ref Sequence ENSEMBL: ENSMUSP00000129322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026999] [ENSMUST00000168918] [ENSMUST00000174411]
Predicted Effect probably damaging
Transcript: ENSMUST00000026999
AA Change: V360A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026999
Gene: ENSMUSG00000025880
AA Change: V360A

DomainStartEndE-ValueType
low complexity region 20 65 N/A INTRINSIC
DWA 87 205 5.36e-51 SMART
DWB 259 424 2.46e-82 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168918
AA Change: V360A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129322
Gene: ENSMUSG00000025880
AA Change: V360A

DomainStartEndE-ValueType
low complexity region 20 65 N/A INTRINSIC
DWA 87 205 5.36e-51 SMART
DWB 259 424 2.46e-82 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172718
Predicted Effect probably damaging
Transcript: ENSMUST00000174411
AA Change: V161A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133696
Gene: ENSMUSG00000025880
AA Change: V161A

DomainStartEndE-ValueType
DWB 60 225 2.46e-82 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174843
SMART Domains Protein: ENSMUSP00000133544
Gene: ENSMUSG00000025880

DomainStartEndE-ValueType
low complexity region 9 54 N/A INTRINSIC
DWA 76 194 5.36e-51 SMART
Pfam:MH2 222 264 4.3e-7 PFAM
Meta Mutation Damage Score 0.9314 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear protein that binds the E3 ubiquitin ligase SMURF2. Upon binding, this complex translocates to the cytoplasm, where it interacts with TGF-beta receptor type-1 (TGFBR1), leading to the degradation of both the encoded protein and TGFBR1. Expression of this gene is induced by TGFBR1. Variations in this gene are a cause of susceptibility to colorectal cancer type 3 (CRCS3). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a hypomorphic allele display partial penetrance of prenatal lethality, reduced body size and weight, smaller litter size and B cell abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 C A 15: 94,333,695 R871L possibly damaging Het
Adcy5 G A 16: 35,268,993 C520Y probably damaging Het
AI661453 G A 17: 47,468,117 probably benign Het
Bptf T C 11: 107,110,844 K481E probably damaging Het
Cnot10 T A 9: 114,631,881 K74* probably null Het
Ctc1 C T 11: 69,022,871 P200S probably damaging Het
Dact1 T C 12: 71,317,185 Y210H probably damaging Het
Dbn1 T C 13: 55,475,381 T430A probably benign Het
Dmd A C X: 83,722,018 T657P probably benign Het
Efnb2 C T 8: 8,620,832 R256H possibly damaging Het
Eif4a1 T C 11: 69,669,244 I116M possibly damaging Het
F730035P03Rik A T 7: 99,780,268 noncoding transcript Het
Fbn1 C T 2: 125,397,781 V329I probably benign Het
Gpr20 G A 15: 73,696,276 T88I probably benign Het
Herc1 T G 9: 66,479,453 V3783G probably benign Het
Khdc1a A G 1: 21,350,393 D79G possibly damaging Het
Klk1b16 A T 7: 44,141,427 I218F probably damaging Het
Malrd1 C T 2: 16,150,783 T2001I unknown Het
Mia3 A G 1: 183,330,878 S556P probably damaging Het
Myo3a T A 2: 22,577,842 D369E probably benign Het
Nelfa T C 5: 33,901,279 D279G possibly damaging Het
Ntrk3 A T 7: 78,250,769 C607* probably null Het
Olfr53 T C 7: 140,652,828 V283A possibly damaging Het
Pclo A T 5: 14,775,366 Q1371L probably damaging Het
Pdzd2 A T 15: 12,375,975 V1358E probably benign Het
Pgr T C 9: 8,903,749 probably null Het
Prag1 A G 8: 36,103,655 D464G probably damaging Het
Prickle4 A G 17: 47,690,531 probably benign Het
Prim2 A G 1: 33,512,111 Y309H probably damaging Het
Prkaa1 A G 15: 5,177,161 Q464R possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rint1 T A 5: 23,794,447 I78K possibly damaging Het
Rnf130 T A 11: 50,071,378 F217Y probably benign Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Stag1 A G 9: 100,956,606 probably benign Het
Tlr12 T A 4: 128,616,195 D754V probably benign Het
Tmf1 G A 6: 97,178,896 P43L probably damaging Het
Togaram1 A G 12: 64,980,856 N873S probably benign Het
Tsn C T 1: 118,311,069 probably benign Het
Ubn1 A G 16: 5,064,425 K250R probably damaging Het
Vmn1r25 A T 6: 57,978,827 V159D probably damaging Het
Vmn2r89 T C 14: 51,452,094 L18P probably damaging Het
Vps8 T G 16: 21,504,466 N689K probably damaging Het
Ythdc1 T A 5: 86,815,654 D30E possibly damaging Het
Ythdc1 G T 5: 86,835,820 probably benign Het
Zfp407 G A 18: 84,562,731 Q86* probably null Het
Zfp521 C T 18: 13,846,544 E271K probably benign Het
Other mutations in Smad7
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0790:Smad7 UTSW 18 75393862 missense probably benign 0.06
R1327:Smad7 UTSW 18 75375945 missense probably benign 0.27
R2026:Smad7 UTSW 18 75394154 missense probably damaging 1.00
R7564:Smad7 UTSW 18 75393835 missense probably benign 0.19
R8018:Smad7 UTSW 18 75369284 missense possibly damaging 0.58
R8064:Smad7 UTSW 18 75394082 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAGGGGAATGGCTTTTGC -3'
(R):5'- CTGTTGAAGATGACCTCCAGCC -3'

Sequencing Primer
(F):5'- TCGGACAGCTCAATTCGGAC -3'
(R):5'- TGACCTCCAGCCAGCACG -3'
Posted On2015-07-06