Incidental Mutation 'R4398:Dmd'
ID325615
Institutional Source Beutler Lab
Gene Symbol Dmd
Ensembl Gene ENSMUSG00000045103
Gene Namedystrophin, muscular dystrophy
SynonymsDp71, mdx, X-linked muscular dystrophy, Dp427, Duchenne muscular dystrophy, pke, dys
MMRRC Submission 041130-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.866) question?
Stock #R4398 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location82948870-85206141 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 83722018 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 657 (T657P)
Ref Sequence ENSEMBL: ENSMUSP00000109633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114000]
Predicted Effect probably benign
Transcript: ENSMUST00000114000
AA Change: T657P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000109633
Gene: ENSMUSG00000045103
AA Change: T657P

DomainStartEndE-ValueType
CH 17 117 5.94e-27 SMART
CH 136 235 3.83e-21 SMART
SPEC 344 448 7.39e-17 SMART
SPEC 453 557 6.49e-13 SMART
SPEC 564 668 9.73e-2 SMART
low complexity region 672 695 N/A INTRINSIC
SPEC 724 829 9.18e-13 SMART
SPEC 835 935 2.28e-1 SMART
SPEC 944 1046 9.34e-2 SMART
SPEC 1053 1155 7.99e-13 SMART
SPEC 1162 1264 7.52e-9 SMART
SPEC 1271 1368 5.53e-7 SMART
SPEC 1470 1569 7.29e-7 SMART
SPEC 1576 1677 8.29e-1 SMART
SPEC 1684 1781 1.82e-1 SMART
SPEC 1786 1875 3.48e0 SMART
SPEC 1882 1972 6.69e-2 SMART
SPEC 2000 2102 1.45e0 SMART
SPEC 2109 2209 6.15e-14 SMART
SPEC 2216 2317 8.9e-11 SMART
low complexity region 2325 2337 N/A INTRINSIC
low complexity region 2432 2444 N/A INTRINSIC
SPEC 2466 2569 1.65e-14 SMART
SPEC 2576 2678 1.2e-7 SMART
SPEC 2685 2794 9.84e-13 SMART
SPEC 2801 2923 8.38e-7 SMART
SPEC 2930 3032 1.21e-12 SMART
WW 3049 3081 1.36e-10 SMART
Pfam:EF-hand_2 3082 3200 1.7e-42 PFAM
Pfam:EF-hand_3 3204 3295 6.6e-41 PFAM
ZnF_ZZ 3300 3345 7.39e-18 SMART
coiled coil region 3488 3598 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147740
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: This gene encodes a large, rod-like cytoskeletal protein which is found at the inner surface of muscle fibers in skeletal and cardiac muscles. The encoded protein, dystrophin, is part of the dystrophin-glycoprotein complex, which bridges the inner cytoskeleton (F-actin) and the extra-cellular matrix. This protein is required for proper development and organization of myofibers as contractile units in striated muscles. Mutations in the human gene cause Duchenne and Becker Muscular Dystrophies and a form of heart disease called DMD-associated dilated cardiomyopathy. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutations in this gene cause muscular dystrophy. Phenotypic variation has been observed in different backgrounds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 C A 15: 94,333,695 R871L possibly damaging Het
Adcy5 G A 16: 35,268,993 C520Y probably damaging Het
AI661453 G A 17: 47,468,117 probably benign Het
Bptf T C 11: 107,110,844 K481E probably damaging Het
Cnot10 T A 9: 114,631,881 K74* probably null Het
Ctc1 C T 11: 69,022,871 P200S probably damaging Het
Dact1 T C 12: 71,317,185 Y210H probably damaging Het
Dbn1 T C 13: 55,475,381 T430A probably benign Het
Efnb2 C T 8: 8,620,832 R256H possibly damaging Het
Eif4a1 T C 11: 69,669,244 I116M possibly damaging Het
F730035P03Rik A T 7: 99,780,268 noncoding transcript Het
Fbn1 C T 2: 125,397,781 V329I probably benign Het
Gpr20 G A 15: 73,696,276 T88I probably benign Het
Herc1 T G 9: 66,479,453 V3783G probably benign Het
Khdc1a A G 1: 21,350,393 D79G possibly damaging Het
Klk1b16 A T 7: 44,141,427 I218F probably damaging Het
Malrd1 C T 2: 16,150,783 T2001I unknown Het
Mia3 A G 1: 183,330,878 S556P probably damaging Het
Myo3a T A 2: 22,577,842 D369E probably benign Het
Nelfa T C 5: 33,901,279 D279G possibly damaging Het
Ntrk3 A T 7: 78,250,769 C607* probably null Het
Olfr53 T C 7: 140,652,828 V283A possibly damaging Het
Pclo A T 5: 14,775,366 Q1371L probably damaging Het
Pdzd2 A T 15: 12,375,975 V1358E probably benign Het
Pgr T C 9: 8,903,749 probably null Het
Prag1 A G 8: 36,103,655 D464G probably damaging Het
Prickle4 A G 17: 47,690,531 probably benign Het
Prim2 A G 1: 33,512,111 Y309H probably damaging Het
Prkaa1 A G 15: 5,177,161 Q464R possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rint1 T A 5: 23,794,447 I78K possibly damaging Het
Rnf130 T A 11: 50,071,378 F217Y probably benign Het
Smad7 T C 18: 75,394,163 V360A probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Stag1 A G 9: 100,956,606 probably benign Het
Tlr12 T A 4: 128,616,195 D754V probably benign Het
Tmf1 G A 6: 97,178,896 P43L probably damaging Het
Togaram1 A G 12: 64,980,856 N873S probably benign Het
Tsn C T 1: 118,311,069 probably benign Het
Ubn1 A G 16: 5,064,425 K250R probably damaging Het
Vmn1r25 A T 6: 57,978,827 V159D probably damaging Het
Vmn2r89 T C 14: 51,452,094 L18P probably damaging Het
Vps8 T G 16: 21,504,466 N689K probably damaging Het
Ythdc1 T A 5: 86,815,654 D30E possibly damaging Het
Ythdc1 G T 5: 86,835,820 probably benign Het
Zfp407 G A 18: 84,562,731 Q86* probably null Het
Zfp521 C T 18: 13,846,544 E271K probably benign Het
Other mutations in Dmd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Dmd APN X 83908372 splice site probably null
IGL00823:Dmd APN X 84425813 splice site probably null
IGL01160:Dmd APN X 83924961 missense probably damaging 1.00
IGL01285:Dmd APN X 85109984 nonsense probably null
IGL01294:Dmd APN X 84431998 splice site probably null
IGL02426:Dmd APN X 84848736 missense probably damaging 1.00
IGL02610:Dmd APN X 83664156 missense probably damaging 1.00
IGL02887:Dmd APN X 83878504 missense probably benign 0.44
IGL03268:Dmd APN X 83806208 missense probably damaging 0.98
IGL03301:Dmd APN X 83908514 missense probably damaging 1.00
R0480:Dmd UTSW X 84425738 missense probably benign 0.00
R0714:Dmd UTSW X 84309897 missense probably benign 0.00
R1296:Dmd UTSW X 83878520 missense probably damaging 1.00
R1448:Dmd UTSW X 84848700 missense probably damaging 0.97
R1678:Dmd UTSW X 84974762 missense probably benign 0.43
R1714:Dmd UTSW X 83964750 missense probably benign 0.17
R1951:Dmd UTSW X 83830517 missense probably damaging 1.00
R1952:Dmd UTSW X 83830517 missense probably damaging 1.00
R1953:Dmd UTSW X 83830517 missense probably damaging 1.00
R1955:Dmd UTSW X 83878557 missense probably benign 0.10
R2072:Dmd UTSW X 84312483 missense probably benign 0.33
R2073:Dmd UTSW X 84312483 missense probably benign 0.33
R2074:Dmd UTSW X 84312483 missense probably benign 0.33
R2075:Dmd UTSW X 84312483 missense probably benign 0.33
R2118:Dmd UTSW X 84312483 missense probably benign 0.33
R2119:Dmd UTSW X 84312483 missense probably benign 0.33
R2120:Dmd UTSW X 84312483 missense probably benign 0.33
R2122:Dmd UTSW X 84312483 missense probably benign 0.33
X0025:Dmd UTSW X 84647194 missense probably benign
Z1088:Dmd UTSW X 83878495 missense possibly damaging 0.67
Z1088:Dmd UTSW X 84575760 missense probably benign 0.05
Z1176:Dmd UTSW X 83627286 missense probably damaging 1.00
Z1176:Dmd UTSW X 83878484 missense possibly damaging 0.90
Z1177:Dmd UTSW X 83627271 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTAGCTACATTTCTCAGCTATAC -3'
(R):5'- AATTTCCCAATACCAGGGCG -3'

Sequencing Primer
(F):5'- TCTCAGCTATACAAAGAAGTAAACAC -3'
(R):5'- CCAATACCAGGGCGAACGAG -3'
Posted On2015-07-06