Incidental Mutation 'R4399:Mup18'
ID325623
Institutional Source Beutler Lab
Gene Symbol Mup18
Ensembl Gene ENSMUSG00000078674
Gene Namemajor urinary protein 18
SynonymsGm12561
MMRRC Submission 041686-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R4399 (G1)
Quality Score92
Status Not validated
Chromosome4
Chromosomal Location61670177-61674136 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 61672629 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 97 (G97D)
Ref Sequence ENSEMBL: ENSMUSP00000095648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098040]
Predicted Effect probably damaging
Transcript: ENSMUST00000098040
AA Change: G97D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095648
Gene: ENSMUSG00000078674
AA Change: G97D

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
Pfam:Lipocalin 35 174 3.4e-34 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (44/46)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T C 11: 109,936,385 T1466A possibly damaging Het
Abcc6 T C 7: 46,002,607 N612S probably benign Het
Aga T C 8: 53,511,826 S8P probably benign Het
Cep152 G A 2: 125,587,980 A674V possibly damaging Het
Chd6 T C 2: 160,965,318 H1992R probably benign Het
Cnga1 T C 5: 72,604,381 K597E probably damaging Het
Col6a5 T A 9: 105,888,965 M1919L possibly damaging Het
Cramp1l C T 17: 24,979,585 V788I probably damaging Het
Dnah7a T C 1: 53,518,727 Y2176C probably damaging Het
Foxred2 A C 15: 77,953,358 V226G possibly damaging Het
Foxred2 T C 15: 77,955,680 I137V probably benign Het
G6pd2 T A 5: 61,810,173 N430K probably benign Het
Gtf2h3 T C 5: 124,602,063 probably benign Het
Ibsp T A 5: 104,309,282 S86T probably damaging Het
Igkv6-25 T A 6: 70,215,710 S34T possibly damaging Het
Mrc2 T A 11: 105,336,658 Y572* probably null Het
Olfr1286 T G 2: 111,420,799 I51L probably benign Het
Olfr347 A T 2: 36,735,230 N303I probably benign Het
Olfr59 A G 11: 74,288,856 D70G probably damaging Het
Olfr706 G T 7: 106,886,453 D121E probably damaging Het
Prkcz A T 4: 155,269,077 I454N possibly damaging Het
Prrg3 A T X: 71,967,309 S141C probably damaging Het
Ralgapa1 T A 12: 55,795,778 probably null Het
Ryr3 A T 2: 112,946,844 S323T probably benign Het
Sbpl A G 17: 23,954,886 L8P unknown Het
Setd1b C T 5: 123,161,798 probably benign Het
Sh2d3c G A 2: 32,746,160 G332D probably damaging Het
Slc2a7 A G 4: 150,158,550 E276G probably damaging Het
Slc35b3 A G 13: 38,937,815 F73L possibly damaging Het
Sstr3 T G 15: 78,540,124 D141A probably damaging Het
St8sia5 T C 18: 77,253,018 C191R probably damaging Het
Sult1c1 T C 17: 53,962,510 N230S probably benign Het
Thrap3 A G 4: 126,167,079 probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Tmem151a A G 19: 5,083,071 S36P probably damaging Het
Vmn1r67 A G 7: 10,447,549 T247A possibly damaging Het
Vmn2r50 A G 7: 10,047,907 S304P possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vmn2r72 T C 7: 85,738,500 N619D probably damaging Het
Xab2 C A 8: 3,614,244 probably null Het
Other mutations in Mup18
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2224:Mup18 UTSW 4 61671891 missense possibly damaging 0.74
R4614:Mup18 UTSW 4 61671917 missense possibly damaging 0.62
R4617:Mup18 UTSW 4 61671917 missense possibly damaging 0.62
R7173:Mup18 UTSW 4 61671962 missense probably benign 0.04
R7198:Mup18 UTSW 4 61673336 intron probably null
R7201:Mup18 UTSW 4 61673336 intron probably null
R7455:Mup18 UTSW 4 61673934 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GGTGCAAGTTCCTGAGTTCAAAC -3'
(R):5'- GCACTGGTGAAACTTGGAGG -3'

Sequencing Primer
(F):5'- AGTTCAAACTCCAGCAAAACAC -3'
(R):5'- GGCAAATTTGTGATTGCTAAAGC -3'
Posted On2015-07-06