Mutagenetix > Incidental Mutations

Incidental Mutation 'R4399:Cnga1'

325628

Institutional Source

Beutler Lab

Gene Symbol

Cnga1

Ensembl Gene

ENSMUSG00000067220

Gene Name

cyclic nucleotide gated channel alpha 1

Synonyms

Cncg

MMRRC Submission

041686-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.325) question?

Stock #

R4399 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

72603696-72644275 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 72604381 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 597 (K597E)

Ref Sequence

ENSEMBL: ENSMUSP00000143881 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087213] [ENSMUST00000169997] [ENSMUST00000201463]

Predicted Effect

probably damaging
Transcript: ENSMUST00000087213
AA Change: K597E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000084464
Gene: ENSMUSG00000067220
AA Change: K597E

Domain	Start	End	E-Value	Type
coiled coil region	111	150	N/A	INTRINSIC
Pfam:Ion_trans	156	400	3e-33	PFAM
cNMP	471	595	3.31e-25	SMART
PDB:3SWF\|C	615	684	6e-31	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000169997
AA Change: K597E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000132329
Gene: ENSMUSG00000067220
AA Change: K597E

Domain	Start	End	E-Value	Type
coiled coil region	111	150	N/A	INTRINSIC
Pfam:Ion_trans	194	388	4.7e-19	PFAM
cNMP	471	595	3.31e-25	SMART
PDB:3SWF\|C	615	684	6e-31	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000201463
AA Change: K597E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000143881
Gene: ENSMUSG00000067220
AA Change: K597E

Domain	Start	End	E-Value	Type
coiled coil region	111	150	N/A	INTRINSIC
Pfam:Ion_trans	156	400	3e-33	PFAM
cNMP	471	595	3.31e-25	SMART
PDB:3SWF\|C	615	684	6e-31	PDB

Meta Mutation Damage Score

0.3636

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

96% (44/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in phototransduction. Along with another protein, the encoded protein forms a cGMP-gated cation channel in the plasma membrane, allowing depolarization of rod photoreceptors. This represents the last step in the phototransduction pathway. Defects in this gene are a cause of retinitis pigmentosa autosomal recessive (ARRP) disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	T	C	11: 109,936,385	T1466A	possibly damaging	Het
Abcc6	T	C	7: 46,002,607	N612S	probably benign	Het
Aga	T	C	8: 53,511,826	S8P	probably benign	Het
Cep152	G	A	2: 125,587,980	A674V	possibly damaging	Het
Chd6	T	C	2: 160,965,318	H1992R	probably benign	Het
Col6a5	T	A	9: 105,888,965	M1919L	possibly damaging	Het
Cramp1l	C	T	17: 24,979,585	V788I	probably damaging	Het
Dnah7a	T	C	1: 53,518,727	Y2176C	probably damaging	Het
Foxred2	A	C	15: 77,953,358	V226G	possibly damaging	Het
Foxred2	T	C	15: 77,955,680	I137V	probably benign	Het
G6pd2	T	A	5: 61,810,173	N430K	probably benign	Het
Gtf2h3	T	C	5: 124,602,063		probably benign	Het
Ibsp	T	A	5: 104,309,282	S86T	probably damaging	Het
Igkv6-25	T	A	6: 70,215,710	S34T	possibly damaging	Het
Mrc2	T	A	11: 105,336,658	Y572*	probably null	Het
Mup18	C	T	4: 61,672,629	G97D	probably damaging	Het
Olfr1286	T	G	2: 111,420,799	I51L	probably benign	Het
Olfr347	A	T	2: 36,735,230	N303I	probably benign	Het
Olfr59	A	G	11: 74,288,856	D70G	probably damaging	Het
Olfr706	G	T	7: 106,886,453	D121E	probably damaging	Het
Prkcz	A	T	4: 155,269,077	I454N	possibly damaging	Het
Prrg3	A	T	X: 71,967,309	S141C	probably damaging	Het
Ralgapa1	T	A	12: 55,795,778		probably null	Het
Ryr3	A	T	2: 112,946,844	S323T	probably benign	Het
Sbpl	A	G	17: 23,954,886	L8P	unknown	Het
Setd1b	C	T	5: 123,161,798		probably benign	Het
Sh2d3c	G	A	2: 32,746,160	G332D	probably damaging	Het
Slc2a7	A	G	4: 150,158,550	E276G	probably damaging	Het
Slc35b3	A	G	13: 38,937,815	F73L	possibly damaging	Het
Sstr3	T	G	15: 78,540,124	D141A	probably damaging	Het
St8sia5	T	C	18: 77,253,018	C191R	probably damaging	Het
Sult1c1	T	C	17: 53,962,510	N230S	probably benign	Het
Thrap3	A	G	4: 126,167,079		probably benign	Het
Tma16	C	T	8: 66,484,171		probably null	Het
Tmem151a	A	G	19: 5,083,071	S36P	probably damaging	Het
Vmn1r67	A	G	7: 10,447,549	T247A	possibly damaging	Het
Vmn2r50	A	G	7: 10,047,907	S304P	possibly damaging	Het
Vmn2r68	TCC	TC	7: 85,221,550		probably null	Het
Vmn2r72	T	C	7: 85,738,500	N619D	probably damaging	Het
Xab2	C	A	8: 3,614,244		probably null	Het

Other mutations in Cnga1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02332:Cnga1	APN	5	72604486	missense	probably damaging	1.00
IGL02345:Cnga1	APN	5	72605272	missense	probably benign	0.00
IGL02354:Cnga1	APN	5	72616718	splice site	probably null
IGL02361:Cnga1	APN	5	72616718	splice site	probably null
IGL03025:Cnga1	APN	5	72605413	missense	probably benign
IGL03257:Cnga1	APN	5	72610862	missense	probably damaging	1.00
IGL03046:Cnga1	UTSW	5	72604338	missense	probably benign	0.01
R0238:Cnga1	UTSW	5	72605031	missense	probably damaging	0.97
R0238:Cnga1	UTSW	5	72605031	missense	probably damaging	0.97
R0352:Cnga1	UTSW	5	72604503	missense	possibly damaging	0.95
R1292:Cnga1	UTSW	5	72604683	missense	probably damaging	1.00
R1386:Cnga1	UTSW	5	72612183	nonsense	probably null
R1903:Cnga1	UTSW	5	72616725	missense	possibly damaging	0.94
R2096:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R2097:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R2101:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R2276:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R2279:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R2507:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R2508:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R3005:Cnga1	UTSW	5	72605107	missense	probably damaging	1.00
R3779:Cnga1	UTSW	5	72604783	missense	probably damaging	1.00
R4357:Cnga1	UTSW	5	72618252	missense	probably damaging	1.00
R4615:Cnga1	UTSW	5	72604774	missense	probably damaging	1.00
R4946:Cnga1	UTSW	5	72604764	missense	probably damaging	1.00
R5229:Cnga1	UTSW	5	72609500	missense	probably damaging	1.00
R5474:Cnga1	UTSW	5	72605193	missense	probably damaging	1.00
R5566:Cnga1	UTSW	5	72618250	missense	probably damaging	0.98
R5754:Cnga1	UTSW	5	72605272	missense	probably benign	0.00
R5899:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R5906:Cnga1	UTSW	5	72610858	missense	probably benign	0.19
R5954:Cnga1	UTSW	5	72604878	missense	probably damaging	0.99
R5997:Cnga1	UTSW	5	72604575	missense	probably damaging	0.98
R6087:Cnga1	UTSW	5	72610812	missense	probably damaging	1.00
R6365:Cnga1	UTSW	5	72604945	missense	probably benign	0.00
R6391:Cnga1	UTSW	5	72612359	critical splice donor site	probably null
R6525:Cnga1	UTSW	5	72618231	missense	probably damaging	1.00
R7046:Cnga1	UTSW	5	72629353	intron	probably benign
R7229:Cnga1	UTSW	5	72618249	missense	probably benign
R7299:Cnga1	UTSW	5	72605432	missense	probably benign	0.20
R7367:Cnga1	UTSW	5	72605358	missense	possibly damaging	0.75
R7425:Cnga1	UTSW	5	72609525	missense	probably benign	0.12
R7449:Cnga1	UTSW	5	72605304	missense	probably benign	0.29
R7538:Cnga1	UTSW	5	72612380	missense	probably benign	0.24
R7808:Cnga1	UTSW	5	72604273	missense	possibly damaging	0.69
X0062:Cnga1	UTSW	5	72604485	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTTCCTCCAGAGCTGAAAATTC -3'
(R):5'- ACGGCAGTTACTTTGGTGAG -3'

Sequencing Primer
(F):5'- AGCGGTTTCAGAAATTTCTCGACC -3'
(R):5'- CAGTTACTTTGGTGAGATCAGC -3'

Posted On

2015-07-06