Incidental Mutation 'R4399:Vmn2r72'
ID325637
Institutional Source Beutler Lab
Gene Symbol Vmn2r72
Ensembl Gene ENSMUSG00000051877
Gene Namevomeronasal 2, receptor 72
SynonymsVmn2r72-ps, EG244114
MMRRC Submission 041686-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R4399 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location85737784-85754981 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85738500 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 619 (N619D)
Ref Sequence ENSEMBL: ENSMUSP00000133014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063425]
Predicted Effect probably damaging
Transcript: ENSMUST00000063425
AA Change: N619D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133014
Gene: ENSMUSG00000051877
AA Change: N619D

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 82 469 2.3e-28 PFAM
Pfam:NCD3G 512 564 1.2e-18 PFAM
Pfam:7tm_3 594 832 4e-53 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (44/46)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T C 11: 109,936,385 T1466A possibly damaging Het
Abcc6 T C 7: 46,002,607 N612S probably benign Het
Aga T C 8: 53,511,826 S8P probably benign Het
Cep152 G A 2: 125,587,980 A674V possibly damaging Het
Chd6 T C 2: 160,965,318 H1992R probably benign Het
Cnga1 T C 5: 72,604,381 K597E probably damaging Het
Col6a5 T A 9: 105,888,965 M1919L possibly damaging Het
Cramp1l C T 17: 24,979,585 V788I probably damaging Het
Dnah7a T C 1: 53,518,727 Y2176C probably damaging Het
Foxred2 A C 15: 77,953,358 V226G possibly damaging Het
Foxred2 T C 15: 77,955,680 I137V probably benign Het
G6pd2 T A 5: 61,810,173 N430K probably benign Het
Gtf2h3 T C 5: 124,602,063 probably benign Het
Ibsp T A 5: 104,309,282 S86T probably damaging Het
Igkv6-25 T A 6: 70,215,710 S34T possibly damaging Het
Mrc2 T A 11: 105,336,658 Y572* probably null Het
Mup18 C T 4: 61,672,629 G97D probably damaging Het
Olfr1286 T G 2: 111,420,799 I51L probably benign Het
Olfr347 A T 2: 36,735,230 N303I probably benign Het
Olfr59 A G 11: 74,288,856 D70G probably damaging Het
Olfr706 G T 7: 106,886,453 D121E probably damaging Het
Prkcz A T 4: 155,269,077 I454N possibly damaging Het
Prrg3 A T X: 71,967,309 S141C probably damaging Het
Ralgapa1 T A 12: 55,795,778 probably null Het
Ryr3 A T 2: 112,946,844 S323T probably benign Het
Sbpl A G 17: 23,954,886 L8P unknown Het
Setd1b C T 5: 123,161,798 probably benign Het
Sh2d3c G A 2: 32,746,160 G332D probably damaging Het
Slc2a7 A G 4: 150,158,550 E276G probably damaging Het
Slc35b3 A G 13: 38,937,815 F73L possibly damaging Het
Sstr3 T G 15: 78,540,124 D141A probably damaging Het
St8sia5 T C 18: 77,253,018 C191R probably damaging Het
Sult1c1 T C 17: 53,962,510 N230S probably benign Het
Thrap3 A G 4: 126,167,079 probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Tmem151a A G 19: 5,083,071 S36P probably damaging Het
Vmn1r67 A G 7: 10,447,549 T247A possibly damaging Het
Vmn2r50 A G 7: 10,047,907 S304P possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Xab2 C A 8: 3,614,244 probably null Het
Other mutations in Vmn2r72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Vmn2r72 APN 7 85749646 missense probably benign 0.01
IGL01019:Vmn2r72 APN 7 85738334 missense probably benign 0.26
IGL01445:Vmn2r72 APN 7 85749646 missense probably benign 0.06
IGL02076:Vmn2r72 APN 7 85738367 missense probably damaging 1.00
IGL02082:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02086:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02089:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02125:Vmn2r72 APN 7 85750711 missense probably benign 0.00
IGL02146:Vmn2r72 APN 7 85737962 missense probably damaging 1.00
IGL02272:Vmn2r72 APN 7 85750693 missense probably benign
IGL02514:Vmn2r72 APN 7 85738699 missense possibly damaging 0.90
IGL02662:Vmn2r72 APN 7 85738183 missense probably benign 0.26
IGL02697:Vmn2r72 APN 7 85738671 missense probably benign 0.36
IGL02733:Vmn2r72 APN 7 85751813 missense probably benign 0.05
IGL03070:Vmn2r72 APN 7 85752041 splice site probably benign
IGL03150:Vmn2r72 APN 7 85751176 missense probably damaging 1.00
IGL03159:Vmn2r72 APN 7 85754954 missense probably benign 0.05
IGL03333:Vmn2r72 APN 7 85750867 missense probably benign 0.10
R0081:Vmn2r72 UTSW 7 85751836 missense probably benign 0.01
R0090:Vmn2r72 UTSW 7 85754876 missense probably benign
R0655:Vmn2r72 UTSW 7 85738111 nonsense probably null
R0778:Vmn2r72 UTSW 7 85749739 missense probably benign 0.00
R1169:Vmn2r72 UTSW 7 85751309 missense probably benign 0.01
R1172:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1173:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1175:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1248:Vmn2r72 UTSW 7 85749188 missense probably benign 0.02
R1302:Vmn2r72 UTSW 7 85738257 missense probably damaging 1.00
R1506:Vmn2r72 UTSW 7 85749211 missense probably benign
R1632:Vmn2r72 UTSW 7 85751792 missense probably benign 0.13
R1775:Vmn2r72 UTSW 7 85738170 missense probably benign 0.01
R1962:Vmn2r72 UTSW 7 85749161 missense probably benign 0.00
R2201:Vmn2r72 UTSW 7 85738236 missense probably benign 0.12
R2290:Vmn2r72 UTSW 7 85738341 missense probably damaging 1.00
R2327:Vmn2r72 UTSW 7 85738256 missense probably damaging 1.00
R2424:Vmn2r72 UTSW 7 85750953 missense probably damaging 1.00
R2655:Vmn2r72 UTSW 7 85751269 missense possibly damaging 0.95
R2860:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R2861:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R2862:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R3009:Vmn2r72 UTSW 7 85749642 missense probably benign 0.00
R3797:Vmn2r72 UTSW 7 85738077 missense probably benign 0.44
R3798:Vmn2r72 UTSW 7 85738077 missense probably benign 0.44
R3902:Vmn2r72 UTSW 7 85749735 missense possibly damaging 0.52
R3959:Vmn2r72 UTSW 7 85751131 missense probably benign 0.36
R3974:Vmn2r72 UTSW 7 85749809 missense probably damaging 1.00
R4421:Vmn2r72 UTSW 7 85738500 missense probably damaging 1.00
R4426:Vmn2r72 UTSW 7 85737828 nonsense probably null
R4522:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4523:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4533:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4691:Vmn2r72 UTSW 7 85737911 nonsense probably null
R4781:Vmn2r72 UTSW 7 85737861 missense probably benign 0.14
R4863:Vmn2r72 UTSW 7 85750598 missense possibly damaging 0.91
R4952:Vmn2r72 UTSW 7 85751109 missense probably benign
R4991:Vmn2r72 UTSW 7 85751130 missense probably damaging 0.99
R4995:Vmn2r72 UTSW 7 85738485 missense probably damaging 1.00
R5095:Vmn2r72 UTSW 7 85737853 missense probably damaging 0.98
R5174:Vmn2r72 UTSW 7 85737840 missense probably benign 0.00
R5276:Vmn2r72 UTSW 7 85738254 missense possibly damaging 0.90
R5395:Vmn2r72 UTSW 7 85750897 missense possibly damaging 0.71
R5560:Vmn2r72 UTSW 7 85751942 missense probably damaging 0.96
R5933:Vmn2r72 UTSW 7 85737850 missense probably benign 0.05
R6033:Vmn2r72 UTSW 7 85737929 missense probably damaging 1.00
R6033:Vmn2r72 UTSW 7 85737929 missense probably damaging 1.00
R6354:Vmn2r72 UTSW 7 85750539 critical splice donor site probably null
R6362:Vmn2r72 UTSW 7 85751174 missense probably damaging 1.00
R6594:Vmn2r72 UTSW 7 85749684 missense probably benign 0.32
R6794:Vmn2r72 UTSW 7 85737996 missense probably damaging 1.00
R7113:Vmn2r72 UTSW 7 85749803 splice site probably null
R7189:Vmn2r72 UTSW 7 85754917 missense probably benign 0.36
R7266:Vmn2r72 UTSW 7 85738274 nonsense probably null
R7323:Vmn2r72 UTSW 7 85750563 missense probably benign
R7426:Vmn2r72 UTSW 7 85751140 missense probably benign
R7606:Vmn2r72 UTSW 7 85751154 missense possibly damaging 0.91
R7651:Vmn2r72 UTSW 7 85751938 missense probably damaging 1.00
R7688:Vmn2r72 UTSW 7 85754890 missense probably benign 0.32
R7753:Vmn2r72 UTSW 7 85750626 missense probably damaging 1.00
R7843:Vmn2r72 UTSW 7 85749630 missense probably benign 0.01
R8157:Vmn2r72 UTSW 7 85751233 missense probably benign 0.09
R8254:Vmn2r72 UTSW 7 85751019 missense probably damaging 1.00
R8389:Vmn2r72 UTSW 7 85751960 missense probably damaging 0.99
R8444:Vmn2r72 UTSW 7 85738175 missense probably benign
Z1176:Vmn2r72 UTSW 7 85749191 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATATACTTGGGTGCCCCTGAC -3'
(R):5'- TGTGTGAAGTGTCGAGAAGATC -3'

Sequencing Primer
(F):5'- TTGGGTGCCCCTGACACAAG -3'
(R):5'- TGAAGTGTCGAGAAGATCAATATGC -3'
Posted On2015-07-06