Incidental Mutation 'R4399:Sstr3'
ID 325649
Institutional Source Beutler Lab
Gene Symbol Sstr3
Ensembl Gene ENSMUSG00000044933
Gene Name somatostatin receptor 3
Synonyms Smstr-3, Smstr3, sst3
MMRRC Submission 041686-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4399 (G1)
Quality Score 160
Status Validated
Chromosome 15
Chromosomal Location 78421208-78428885 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 78424324 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 141 (D141A)
Ref Sequence ENSEMBL: ENSMUSP00000058040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053239] [ENSMUST00000230400]
AlphaFold P30935
Predicted Effect probably damaging
Transcript: ENSMUST00000053239
AA Change: D141A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058040
Gene: ENSMUSG00000044933
AA Change: D141A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 53 291 1.9e-8 PFAM
Pfam:7TM_GPCR_Srsx 56 337 3.5e-15 PFAM
Pfam:7tm_1 62 322 6.3e-60 PFAM
Pfam:7TM_GPCR_Srv 121 337 9.5e-8 PFAM
coiled coil region 355 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000230400
Meta Mutation Damage Score 0.8799 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (44/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the somatostatin receptor protein family. Somatostatins are peptide hormones that regulate diverse cellular functions such as neurotransmission, cell proliferation, and endocrine signaling as well as inhibiting the release of many hormones and other secretory proteins. Somatostatin has two active forms of 14 and 28 amino acids. The biological effects of somatostatins are mediated by a family of G-protein coupled somatostatin receptors that are expressed in a tissue-specific manner. Somatostatin receptors form homodimers and heterodimers with other members of the superfamily as well as with other G-protein coupled receptors and receptor tyrosine kinases. This protein is functionally coupled to adenylyl cyclase. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T C 11: 109,827,211 (GRCm39) T1466A possibly damaging Het
Abcc6 T C 7: 45,652,031 (GRCm39) N612S probably benign Het
Aga T C 8: 53,964,861 (GRCm39) S8P probably benign Het
Cep152 G A 2: 125,429,900 (GRCm39) A674V possibly damaging Het
Chd6 T C 2: 160,807,238 (GRCm39) H1992R probably benign Het
Cnga1 T C 5: 72,761,724 (GRCm39) K597E probably damaging Het
Col6a5 T A 9: 105,766,164 (GRCm39) M1919L possibly damaging Het
Cramp1 C T 17: 25,198,559 (GRCm39) V788I probably damaging Het
Dnah7a T C 1: 53,557,886 (GRCm39) Y2176C probably damaging Het
Foxred2 A C 15: 77,837,558 (GRCm39) V226G possibly damaging Het
Foxred2 T C 15: 77,839,880 (GRCm39) I137V probably benign Het
G6pd2 T A 5: 61,967,516 (GRCm39) N430K probably benign Het
Gtf2h3 T C 5: 124,740,126 (GRCm39) probably benign Het
Ibsp T A 5: 104,457,148 (GRCm39) S86T probably damaging Het
Igkv6-25 T A 6: 70,192,694 (GRCm39) S34T possibly damaging Het
Mrc2 T A 11: 105,227,484 (GRCm39) Y572* probably null Het
Mup18 C T 4: 61,590,866 (GRCm39) G97D probably damaging Het
Or1j18 A T 2: 36,625,242 (GRCm39) N303I probably benign Het
Or1p1 A G 11: 74,179,682 (GRCm39) D70G probably damaging Het
Or2ag2 G T 7: 106,485,660 (GRCm39) D121E probably damaging Het
Or4k40 T G 2: 111,251,144 (GRCm39) I51L probably benign Het
Prkcz A T 4: 155,353,534 (GRCm39) I454N possibly damaging Het
Prrg3 A T X: 71,010,915 (GRCm39) S141C probably damaging Het
Ralgapa1 T A 12: 55,842,563 (GRCm39) probably null Het
Ryr3 A T 2: 112,777,189 (GRCm39) S323T probably benign Het
Sbpl A G 17: 24,173,860 (GRCm39) L8P unknown Het
Setd1b C T 5: 123,299,861 (GRCm39) probably benign Het
Sh2d3c G A 2: 32,636,172 (GRCm39) G332D probably damaging Het
Slc2a7 A G 4: 150,243,007 (GRCm39) E276G probably damaging Het
Slc35b3 A G 13: 39,121,791 (GRCm39) F73L possibly damaging Het
St8sia5 T C 18: 77,340,714 (GRCm39) C191R probably damaging Het
Sult1c2 T C 17: 54,269,538 (GRCm39) N230S probably benign Het
Thrap3 A G 4: 126,060,872 (GRCm39) probably benign Het
Tma16 C T 8: 66,936,823 (GRCm39) probably null Het
Tmem151a A G 19: 5,133,099 (GRCm39) S36P probably damaging Het
Vmn1r67 A G 7: 10,181,476 (GRCm39) T247A possibly damaging Het
Vmn2r50 A G 7: 9,781,834 (GRCm39) S304P possibly damaging Het
Vmn2r68 TCC TC 7: 84,870,758 (GRCm39) probably null Het
Vmn2r72 T C 7: 85,387,708 (GRCm39) N619D probably damaging Het
Xab2 C A 8: 3,664,244 (GRCm39) probably null Het
Other mutations in Sstr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Sstr3 APN 15 78,424,667 (GRCm39) missense probably benign 0.00
R0442:Sstr3 UTSW 15 78,424,597 (GRCm39) missense probably damaging 0.99
R1714:Sstr3 UTSW 15 78,424,473 (GRCm39) missense probably damaging 1.00
R1865:Sstr3 UTSW 15 78,424,168 (GRCm39) missense probably damaging 1.00
R2008:Sstr3 UTSW 15 78,424,711 (GRCm39) missense probably benign 0.14
R2351:Sstr3 UTSW 15 78,424,121 (GRCm39) missense probably benign 0.01
R3023:Sstr3 UTSW 15 78,424,187 (GRCm39) missense probably damaging 0.99
R3024:Sstr3 UTSW 15 78,424,187 (GRCm39) missense probably damaging 0.99
R3770:Sstr3 UTSW 15 78,424,577 (GRCm39) missense probably damaging 1.00
R4724:Sstr3 UTSW 15 78,423,897 (GRCm39) nonsense probably null
R6181:Sstr3 UTSW 15 78,423,661 (GRCm39) missense probably benign
R6247:Sstr3 UTSW 15 78,423,788 (GRCm39) missense probably damaging 0.99
R7450:Sstr3 UTSW 15 78,424,043 (GRCm39) missense probably damaging 1.00
R7578:Sstr3 UTSW 15 78,424,717 (GRCm39) missense probably benign
R7793:Sstr3 UTSW 15 78,424,588 (GRCm39) missense probably damaging 1.00
R8336:Sstr3 UTSW 15 78,424,693 (GRCm39) missense probably damaging 1.00
R9263:Sstr3 UTSW 15 78,423,792 (GRCm39) missense probably damaging 1.00
R9264:Sstr3 UTSW 15 78,423,792 (GRCm39) missense probably damaging 1.00
R9265:Sstr3 UTSW 15 78,423,792 (GRCm39) missense probably damaging 1.00
X0026:Sstr3 UTSW 15 78,423,574 (GRCm39) missense possibly damaging 0.57
Z1177:Sstr3 UTSW 15 78,423,503 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGGCCGTGTAGATGATGAAG -3'
(R):5'- GTGACCAGTGTCTATATCCTCAAC -3'

Sequencing Primer
(F):5'- AGATGATGAAGGCTGTTCGC -3'
(R):5'- AACCTGGCTCTGGCTGATGAG -3'
Posted On 2015-07-06