Incidental Mutation 'R4399:Cramp1l'
ID325651
Institutional Source Beutler Lab
Gene Symbol Cramp1l
Ensembl Gene ENSMUSG00000038002
Gene Namecramped chromatin regulator homolog 1
Synonyms5830477H08Rik, Tce4
MMRRC Submission 041686-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4399 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location24961228-25015230 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24979585 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 788 (V788I)
Ref Sequence ENSEMBL: ENSMUSP00000073060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073337]
Predicted Effect probably damaging
Transcript: ENSMUST00000073337
AA Change: V788I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000073060
Gene: ENSMUSG00000038002
AA Change: V788I

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
low complexity region 29 43 N/A INTRINSIC
low complexity region 51 64 N/A INTRINSIC
low complexity region 100 126 N/A INTRINSIC
low complexity region 134 147 N/A INTRINSIC
SANT 159 219 3.68e-3 SMART
low complexity region 479 503 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 833 845 N/A INTRINSIC
low complexity region 889 903 N/A INTRINSIC
low complexity region 1069 1086 N/A INTRINSIC
low complexity region 1113 1124 N/A INTRINSIC
low complexity region 1141 1156 N/A INTRINSIC
low complexity region 1171 1185 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (44/46)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T C 11: 109,936,385 T1466A possibly damaging Het
Abcc6 T C 7: 46,002,607 N612S probably benign Het
Aga T C 8: 53,511,826 S8P probably benign Het
Cep152 G A 2: 125,587,980 A674V possibly damaging Het
Chd6 T C 2: 160,965,318 H1992R probably benign Het
Cnga1 T C 5: 72,604,381 K597E probably damaging Het
Col6a5 T A 9: 105,888,965 M1919L possibly damaging Het
Dnah7a T C 1: 53,518,727 Y2176C probably damaging Het
Foxred2 A C 15: 77,953,358 V226G possibly damaging Het
Foxred2 T C 15: 77,955,680 I137V probably benign Het
G6pd2 T A 5: 61,810,173 N430K probably benign Het
Gtf2h3 T C 5: 124,602,063 probably benign Het
Ibsp T A 5: 104,309,282 S86T probably damaging Het
Igkv6-25 T A 6: 70,215,710 S34T possibly damaging Het
Mrc2 T A 11: 105,336,658 Y572* probably null Het
Mup18 C T 4: 61,672,629 G97D probably damaging Het
Olfr1286 T G 2: 111,420,799 I51L probably benign Het
Olfr347 A T 2: 36,735,230 N303I probably benign Het
Olfr59 A G 11: 74,288,856 D70G probably damaging Het
Olfr706 G T 7: 106,886,453 D121E probably damaging Het
Prkcz A T 4: 155,269,077 I454N possibly damaging Het
Prrg3 A T X: 71,967,309 S141C probably damaging Het
Ralgapa1 T A 12: 55,795,778 probably null Het
Ryr3 A T 2: 112,946,844 S323T probably benign Het
Sbpl A G 17: 23,954,886 L8P unknown Het
Setd1b C T 5: 123,161,798 probably benign Het
Sh2d3c G A 2: 32,746,160 G332D probably damaging Het
Slc2a7 A G 4: 150,158,550 E276G probably damaging Het
Slc35b3 A G 13: 38,937,815 F73L possibly damaging Het
Sstr3 T G 15: 78,540,124 D141A probably damaging Het
St8sia5 T C 18: 77,253,018 C191R probably damaging Het
Sult1c1 T C 17: 53,962,510 N230S probably benign Het
Thrap3 A G 4: 126,167,079 probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Tmem151a A G 19: 5,083,071 S36P probably damaging Het
Vmn1r67 A G 7: 10,447,549 T247A possibly damaging Het
Vmn2r50 A G 7: 10,047,907 S304P possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vmn2r72 T C 7: 85,738,500 N619D probably damaging Het
Xab2 C A 8: 3,614,244 probably null Het
Other mutations in Cramp1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Cramp1l APN 17 24983951 missense probably benign 0.11
IGL01360:Cramp1l APN 17 24997573 missense probably damaging 1.00
IGL01966:Cramp1l APN 17 24982943 missense probably benign 0.01
IGL02211:Cramp1l APN 17 24977636 missense possibly damaging 0.94
IGL02474:Cramp1l APN 17 24985050 missense probably damaging 0.98
IGL02798:Cramp1l APN 17 24968920 splice site probably benign
IGL03340:Cramp1l APN 17 24973542 missense probably damaging 1.00
R0106:Cramp1l UTSW 17 24972376 missense probably benign 0.30
R1054:Cramp1l UTSW 17 24983177 missense probably damaging 1.00
R1220:Cramp1l UTSW 17 24982237 missense probably damaging 1.00
R1341:Cramp1l UTSW 17 24977540 missense probably damaging 1.00
R1491:Cramp1l UTSW 17 24972349 missense probably benign 0.17
R1610:Cramp1l UTSW 17 24983951 missense probably benign 0.11
R1649:Cramp1l UTSW 17 24983243 missense probably damaging 1.00
R1795:Cramp1l UTSW 17 24964910 missense probably damaging 1.00
R1856:Cramp1l UTSW 17 24968978 missense probably damaging 1.00
R1881:Cramp1l UTSW 17 24977682 splice site probably benign
R1968:Cramp1l UTSW 17 24964939 missense probably damaging 1.00
R2047:Cramp1l UTSW 17 25003215 nonsense probably null
R2099:Cramp1l UTSW 17 24973085 missense probably benign 0.01
R2298:Cramp1l UTSW 17 24997480 missense probably damaging 0.96
R3752:Cramp1l UTSW 17 24971558 missense probably damaging 1.00
R3821:Cramp1l UTSW 17 24974782 missense probably damaging 1.00
R3861:Cramp1l UTSW 17 24997614 splice site probably benign
R4847:Cramp1l UTSW 17 24985089 missense probably damaging 1.00
R4883:Cramp1l UTSW 17 24982319 missense probably benign
R5579:Cramp1l UTSW 17 24973113 missense possibly damaging 0.89
R5631:Cramp1l UTSW 17 24985603 missense possibly damaging 0.93
R5716:Cramp1l UTSW 17 24974735 missense probably damaging 0.99
R6589:Cramp1l UTSW 17 24977492 splice site probably null
R6631:Cramp1l UTSW 17 24983957 missense probably benign 0.40
R7307:Cramp1l UTSW 17 24974745 missense possibly damaging 0.94
R7323:Cramp1l UTSW 17 24982405 missense possibly damaging 0.90
R7672:Cramp1l UTSW 17 24982466 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGTGTTCGTCATCCCCAATG -3'
(R):5'- TTGCCACCATGGAAATGGATG -3'

Sequencing Primer
(F):5'- TTACTATGCCCACTAGACCATGGG -3'
(R):5'- AAATGGATGGCCTTAGGATACTTGC -3'
Posted On2015-07-06