Incidental Mutation 'R4364:Eif4e2'
ID325656
Institutional Source Beutler Lab
Gene Symbol Eif4e2
Ensembl Gene ENSMUSG00000026254
Gene Nameeukaryotic translation initiation factor 4E member 2
Synonyms2700069E09Rik, D0H0S6743E, Eif4el3
MMRRC Submission 041672-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4364 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location87213914-87240488 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87224371 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 97 (F97L)
Ref Sequence ENSEMBL: ENSMUSP00000108859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050876] [ENSMUST00000076362] [ENSMUST00000113230] [ENSMUST00000113231] [ENSMUST00000113232] [ENSMUST00000113233] [ENSMUST00000113235] [ENSMUST00000123735]
Predicted Effect probably benign
Transcript: ENSMUST00000050876
AA Change: F97L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000053403
Gene: ENSMUSG00000026254
AA Change: F97L

DomainStartEndE-ValueType
Pfam:IF4E 55 217 2.4e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076362
AA Change: F97L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000075699
Gene: ENSMUSG00000026254
AA Change: F97L

DomainStartEndE-ValueType
Pfam:IF4E 55 217 4.1e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113230
AA Change: F92L

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000108856
Gene: ENSMUSG00000026254
AA Change: F92L

DomainStartEndE-ValueType
Pfam:IF4E 50 212 1.7e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113231
AA Change: F92L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000108857
Gene: ENSMUSG00000026254
AA Change: F92L

DomainStartEndE-ValueType
Pfam:IF4E 50 212 4.4e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113232
AA Change: F97L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000108858
Gene: ENSMUSG00000026254
AA Change: F97L

DomainStartEndE-ValueType
Pfam:IF4E 55 217 4e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113233
AA Change: F97L

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000108859
Gene: ENSMUSG00000026254
AA Change: F97L

DomainStartEndE-ValueType
Pfam:IF4E 55 217 8.6e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113235
AA Change: F97L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000108861
Gene: ENSMUSG00000026254
AA Change: F97L

DomainStartEndE-ValueType
Pfam:IF4E 55 217 1.8e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123735
AA Change: F92L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000137771
Gene: ENSMUSG00000026254
AA Change: F92L

DomainStartEndE-ValueType
Pfam:IF4E 50 128 1.8e-33 PFAM
Meta Mutation Damage Score 0.0643 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 93% (40/43)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display complete neonatal lethality, cyanosis, decreased birth weight and decreased brain size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 T G 4: 59,082,294 T445P possibly damaging Het
Amn A C 12: 111,271,762 N37H probably damaging Het
Apoa5 A T 9: 46,270,529 D301V probably damaging Het
Atrn A G 2: 130,970,208 E691G probably benign Het
Ccer1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 10: 97,694,370 probably benign Het
Cct2 A G 10: 117,055,151 V396A probably damaging Het
Dhx35 C T 2: 158,842,352 Q516* probably null Het
Dopey2 A G 16: 93,770,924 K1413R probably benign Het
Dpp9 T C 17: 56,187,391 H856R possibly damaging Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Exoc6b A T 6: 85,003,179 probably benign Het
Fat1 T A 8: 44,952,962 S917T probably benign Het
Frem1 A T 4: 82,913,251 Y2043N probably damaging Het
Galnt14 A G 17: 73,512,159 I312T probably damaging Het
Glipr1 T C 10: 111,985,637 N220S possibly damaging Het
Grid1 A G 14: 34,946,032 E172G probably benign Het
Hspa4l C A 3: 40,766,809 probably null Het
Il1rl2 G T 1: 40,351,791 R298L probably benign Het
Il7r T A 15: 9,512,928 H165L probably damaging Het
Krt83 T G 15: 101,487,514 M326L probably benign Het
Lcn10 G T 2: 25,684,040 C85F probably damaging Het
Nup205 C A 6: 35,192,027 P397Q probably benign Het
Olfr1293-ps G A 2: 111,527,640 V127M probably benign Het
Olfr1425 A G 19: 12,074,497 V45A probably benign Het
Olfr876 A T 9: 37,804,190 H93L probably benign Het
Prkce C T 17: 86,476,851 T218I probably damaging Het
Rhbdl2 T A 4: 123,809,935 M1K probably null Het
Ripor2 C T 13: 24,721,711 P947S probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sptbn5 A G 2: 120,068,655 L428P probably damaging Het
Syne1 A G 10: 5,353,987 V789A probably damaging Het
Taar8c C T 10: 24,101,579 V112M probably benign Het
Tex10 T C 4: 48,468,774 I51V probably benign Het
Ttll1 T A 15: 83,499,994 Q144L probably damaging Het
Other mutations in Eif4e2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R5686:Eif4e2 UTSW 1 87226238 splice site probably null
R5910:Eif4e2 UTSW 1 87220974 missense probably damaging 1.00
R6082:Eif4e2 UTSW 1 87226234 critical splice donor site probably null
Z1176:Eif4e2 UTSW 1 87225939 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGGCCAGCAGTTTTCATAAAC -3'
(R):5'- CAAAAGTCTTTTAACCCTGGCAG -3'

Sequencing Primer
(F):5'- GTTAAACCAGAGTACTTGGCCCTG -3'
(R):5'- GCTCCTAAAAGCAGCTAG -3'
Posted On2015-07-06