Incidental Mutation 'R4364:Olfr1293-ps'
ID325659
Institutional Source Beutler Lab
Gene Symbol Olfr1293-ps
Ensembl Gene ENSMUSG00000108908
Gene Nameolfactory receptor 1293, pseudogene
SynonymsMOR245-24P, OTTMUSG00000015076, GA_x6K02T2Q125-72578807-72579745
MMRRC Submission 041672-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R4364 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111525203-111533279 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 111527640 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 127 (V127M)
Ref Sequence ENSEMBL: ENSMUSP00000151814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102551] [ENSMUST00000120021] [ENSMUST00000215245] [ENSMUST00000217845]
Predicted Effect probably benign
Transcript: ENSMUST00000102551
AA Change: V109M

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000099611
Gene: ENSMUSG00000108908
AA Change: V109M

DomainStartEndE-ValueType
Pfam:7tm_4 17 289 6e-45 PFAM
Pfam:7TM_GPCR_Srsx 20 288 1.4e-7 PFAM
Pfam:7tm_1 27 273 7e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120021
AA Change: V112M
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208680
Predicted Effect probably benign
Transcript: ENSMUST00000215245
AA Change: V127M

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000217845
AA Change: V127M

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.1103 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 93% (40/43)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 T G 4: 59,082,294 T445P possibly damaging Het
Amn A C 12: 111,271,762 N37H probably damaging Het
Apoa5 A T 9: 46,270,529 D301V probably damaging Het
Atrn A G 2: 130,970,208 E691G probably benign Het
Ccer1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 10: 97,694,370 probably benign Het
Cct2 A G 10: 117,055,151 V396A probably damaging Het
Dhx35 C T 2: 158,842,352 Q516* probably null Het
Dopey2 A G 16: 93,770,924 K1413R probably benign Het
Dpp9 T C 17: 56,187,391 H856R possibly damaging Het
Eif4e2 T C 1: 87,224,371 F97L probably benign Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Exoc6b A T 6: 85,003,179 probably benign Het
Fat1 T A 8: 44,952,962 S917T probably benign Het
Frem1 A T 4: 82,913,251 Y2043N probably damaging Het
Galnt14 A G 17: 73,512,159 I312T probably damaging Het
Glipr1 T C 10: 111,985,637 N220S possibly damaging Het
Grid1 A G 14: 34,946,032 E172G probably benign Het
Hspa4l C A 3: 40,766,809 probably null Het
Il1rl2 G T 1: 40,351,791 R298L probably benign Het
Il7r T A 15: 9,512,928 H165L probably damaging Het
Krt83 T G 15: 101,487,514 M326L probably benign Het
Lcn10 G T 2: 25,684,040 C85F probably damaging Het
Nup205 C A 6: 35,192,027 P397Q probably benign Het
Olfr1425 A G 19: 12,074,497 V45A probably benign Het
Olfr876 A T 9: 37,804,190 H93L probably benign Het
Prkce C T 17: 86,476,851 T218I probably damaging Het
Rhbdl2 T A 4: 123,809,935 M1K probably null Het
Ripor2 C T 13: 24,721,711 P947S probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sptbn5 A G 2: 120,068,655 L428P probably damaging Het
Syne1 A G 10: 5,353,987 V789A probably damaging Het
Taar8c C T 10: 24,101,579 V112M probably benign Het
Tex10 T C 4: 48,468,774 I51V probably benign Het
Ttll1 T A 15: 83,499,994 Q144L probably damaging Het
Other mutations in Olfr1293-ps
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3933:Olfr1293-ps UTSW 2 111527955 missense probably damaging 1.00
R4231:Olfr1293-ps UTSW 2 111528201 missense probably damaging 1.00
R4935:Olfr1293-ps UTSW 2 111527448 missense probably damaging 1.00
R4957:Olfr1293-ps UTSW 2 111528224 missense probably benign 0.00
R4959:Olfr1293-ps UTSW 2 111527624 missense probably damaging 1.00
R4973:Olfr1293-ps UTSW 2 111527624 missense probably damaging 1.00
R5333:Olfr1293-ps UTSW 2 111527703 missense probably benign
R6087:Olfr1293-ps UTSW 2 111528181 missense possibly damaging 0.81
R6431:Olfr1293-ps UTSW 2 111527656 missense probably damaging 1.00
R8189:Olfr1293-ps UTSW 2 111527773 missense
R8345:Olfr1293-ps UTSW 2 111527519 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGCCTCTCTGATTCTCAGG -3'
(R):5'- ACCTTATTGGGACCACAAAAGGG -3'

Sequencing Primer
(F):5'- TGTCATGACAGTAACCTATGACTCC -3'
(R):5'- CCACAAAAGGGTAAGTTGACGGC -3'
Posted On2015-07-06