Incidental Mutation 'R4364:Hspa4l'
ID 325663
Institutional Source Beutler Lab
Gene Symbol Hspa4l
Ensembl Gene ENSMUSG00000025757
Gene Name heat shock protein 4 like
Synonyms Osp94, APG-1, 94kDa
MMRRC Submission 041672-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.230) question?
Stock # R4364 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 40699814-40750538 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) C to A at 40721241 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108086] [ENSMUST00000203353] [ENSMUST00000204702]
AlphaFold P48722
Predicted Effect probably null
Transcript: ENSMUST00000108086
SMART Domains Protein: ENSMUSP00000103721
Gene: ENSMUSG00000025757

DomainStartEndE-ValueType
Pfam:HSP70 11 673 2.1e-171 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000203353
SMART Domains Protein: ENSMUSP00000144787
Gene: ENSMUSG00000025757

DomainStartEndE-ValueType
Pfam:HSP70 3 570 6.2e-184 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000204702
SMART Domains Protein: ENSMUSP00000145468
Gene: ENSMUSG00000025757

DomainStartEndE-ValueType
Pfam:HSP70 3 694 1.3e-192 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 93% (40/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is heat shock inducible and may act as a chaperone. The encoded protein can protect the heat-shocked cell against the harmful effects of aggregated proteins. This gene is highly expressed in leukemia cells and may be a good target for therapeutic intervention. Several transcripts encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display increased incidence of male infertility, due to reduced number of mature sperm and reduced sperm motility, and hydronephrosis development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amn A C 12: 111,238,196 (GRCm39) N37H probably damaging Het
Apoa5 A T 9: 46,181,827 (GRCm39) D301V probably damaging Het
Atrn A G 2: 130,812,128 (GRCm39) E691G probably benign Het
Ccer1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 10: 97,530,232 (GRCm39) probably benign Het
Cct2 A G 10: 116,891,056 (GRCm39) V396A probably damaging Het
Dhx35 C T 2: 158,684,272 (GRCm39) Q516* probably null Het
Dop1b A G 16: 93,567,812 (GRCm39) K1413R probably benign Het
Dpp9 T C 17: 56,494,391 (GRCm39) H856R possibly damaging Het
Eif4e2 T C 1: 87,152,093 (GRCm39) F97L probably benign Het
Exoc6b A T 6: 84,980,161 (GRCm39) probably benign Het
Fat1 T A 8: 45,405,999 (GRCm39) S917T probably benign Het
Frem1 A T 4: 82,831,488 (GRCm39) Y2043N probably damaging Het
Galnt14 A G 17: 73,819,154 (GRCm39) I312T probably damaging Het
Glipr1 T C 10: 111,821,542 (GRCm39) N220S possibly damaging Het
Grid1 A G 14: 34,667,989 (GRCm39) E172G probably benign Het
Il1rl2 G T 1: 40,390,951 (GRCm39) R298L probably benign Het
Il7r T A 15: 9,513,014 (GRCm39) H165L probably damaging Het
Krt87 T G 15: 101,385,395 (GRCm39) M326L probably benign Het
Lcn10 G T 2: 25,574,052 (GRCm39) C85F probably damaging Het
Mideas C T 12: 84,203,245 (GRCm39) G886S probably benign Het
Nup205 C A 6: 35,168,962 (GRCm39) P397Q probably benign Het
Or4d10 A G 19: 12,051,861 (GRCm39) V45A probably benign Het
Or4f17-ps1 G A 2: 111,357,985 (GRCm39) V127M probably benign Het
Or8b12c A T 9: 37,715,486 (GRCm39) H93L probably benign Het
Prkce C T 17: 86,784,279 (GRCm39) T218I probably damaging Het
Rhbdl2 T A 4: 123,703,728 (GRCm39) M1K probably null Het
Ripor2 C T 13: 24,905,694 (GRCm39) P947S probably benign Het
Shoc1 T G 4: 59,082,294 (GRCm39) T445P possibly damaging Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Sptbn5 A G 2: 119,899,136 (GRCm39) L428P probably damaging Het
Syne1 A G 10: 5,303,987 (GRCm39) V789A probably damaging Het
Taar8c C T 10: 23,977,477 (GRCm39) V112M probably benign Het
Tex10 T C 4: 48,468,774 (GRCm39) I51V probably benign Het
Ttll1 T A 15: 83,384,195 (GRCm39) Q144L probably damaging Het
Other mutations in Hspa4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02466:Hspa4l APN 3 40,707,657 (GRCm39) nonsense probably null
IGL02605:Hspa4l APN 3 40,736,055 (GRCm39) missense probably benign 0.20
IGL02719:Hspa4l APN 3 40,727,090 (GRCm39) missense possibly damaging 0.60
R0281:Hspa4l UTSW 3 40,739,840 (GRCm39) splice site probably benign
R0398:Hspa4l UTSW 3 40,711,429 (GRCm39) splice site probably benign
R0487:Hspa4l UTSW 3 40,738,758 (GRCm39) missense possibly damaging 0.87
R0610:Hspa4l UTSW 3 40,733,832 (GRCm39) missense probably benign 0.01
R0760:Hspa4l UTSW 3 40,739,155 (GRCm39) nonsense probably null
R1491:Hspa4l UTSW 3 40,741,226 (GRCm39) missense probably benign 0.00
R1720:Hspa4l UTSW 3 40,736,049 (GRCm39) nonsense probably null
R1984:Hspa4l UTSW 3 40,714,833 (GRCm39) missense probably damaging 1.00
R1986:Hspa4l UTSW 3 40,714,833 (GRCm39) missense probably damaging 1.00
R2100:Hspa4l UTSW 3 40,727,090 (GRCm39) missense possibly damaging 0.60
R3706:Hspa4l UTSW 3 40,736,125 (GRCm39) missense possibly damaging 0.55
R3708:Hspa4l UTSW 3 40,736,125 (GRCm39) missense possibly damaging 0.55
R3856:Hspa4l UTSW 3 40,739,821 (GRCm39) missense probably benign 0.29
R3874:Hspa4l UTSW 3 40,727,074 (GRCm39) missense probably damaging 1.00
R3890:Hspa4l UTSW 3 40,736,026 (GRCm39) missense possibly damaging 0.90
R4256:Hspa4l UTSW 3 40,700,435 (GRCm39) missense probably benign 0.03
R4365:Hspa4l UTSW 3 40,721,241 (GRCm39) splice site probably null
R4366:Hspa4l UTSW 3 40,721,241 (GRCm39) splice site probably null
R4493:Hspa4l UTSW 3 40,722,434 (GRCm39) missense possibly damaging 0.77
R4494:Hspa4l UTSW 3 40,707,636 (GRCm39) missense possibly damaging 0.86
R4954:Hspa4l UTSW 3 40,739,832 (GRCm39) critical splice donor site probably null
R4994:Hspa4l UTSW 3 40,700,081 (GRCm39) utr 5 prime probably benign
R5114:Hspa4l UTSW 3 40,700,197 (GRCm39) missense possibly damaging 0.60
R5133:Hspa4l UTSW 3 40,741,179 (GRCm39) missense possibly damaging 0.94
R5202:Hspa4l UTSW 3 40,736,001 (GRCm39) missense probably benign 0.17
R5440:Hspa4l UTSW 3 40,736,008 (GRCm39) missense probably damaging 1.00
R5635:Hspa4l UTSW 3 40,700,177 (GRCm39) missense probably damaging 1.00
R5997:Hspa4l UTSW 3 40,722,411 (GRCm39) missense probably damaging 0.99
R6012:Hspa4l UTSW 3 40,736,031 (GRCm39) missense probably benign 0.09
R6515:Hspa4l UTSW 3 40,736,014 (GRCm39) missense possibly damaging 0.82
R6589:Hspa4l UTSW 3 40,711,487 (GRCm39) missense probably damaging 0.99
R7091:Hspa4l UTSW 3 40,736,024 (GRCm39) missense probably benign 0.00
R7601:Hspa4l UTSW 3 40,738,788 (GRCm39) critical splice donor site probably null
R8072:Hspa4l UTSW 3 40,741,178 (GRCm39) missense probably damaging 0.98
R9103:Hspa4l UTSW 3 40,715,349 (GRCm39) critical splice donor site probably null
R9146:Hspa4l UTSW 3 40,736,101 (GRCm39) missense probably benign 0.15
R9762:Hspa4l UTSW 3 40,727,057 (GRCm39) missense probably benign 0.01
Z1088:Hspa4l UTSW 3 40,721,425 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACATAAGTCCCTAGCTTGTTCTGC -3'
(R):5'- TGACGCGTTTGCACTCATCAG -3'

Sequencing Primer
(F):5'- AGCACTGTACCTGCAAGCCTG -3'
(R):5'- GTTTGCACTCATCAGCTTCTTTAG -3'
Posted On 2015-07-06