Incidental Mutation 'R4364:Rhbdl2'
ID 325667
Institutional Source Beutler Lab
Gene Symbol Rhbdl2
Ensembl Gene ENSMUSG00000043333
Gene Name rhomboid like 2
Synonyms
MMRRC Submission 041672-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4364 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 123681667-123723697 bp(+) (GRCm39)
Type of Mutation start codon destroyed
DNA Base Change (assembly) T to A at 123703728 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000101810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053202] [ENSMUST00000106204]
AlphaFold A2AGA4
Predicted Effect probably null
Transcript: ENSMUST00000053202
AA Change: M1K

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000054546
Gene: ENSMUSG00000043333
AA Change: M1K

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Rhomboid 113 268 7.1e-39 PFAM
transmembrane domain 277 299 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106204
AA Change: M1K

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101810
Gene: ENSMUSG00000043333
AA Change: M1K

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Rhomboid 113 268 1.8e-38 PFAM
transmembrane domain 277 299 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150286
Meta Mutation Damage Score 0.9718 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 93% (40/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the rhomboid family of integral membrane proteins. This family contains proteins that are related to Drosophila rhomboid protein. Members of this family are found in both prokaryotes and eukaryotes and are thought to function as intramembrane serine proteases. The encoded protein is thought to release soluble growth factors by proteolytic cleavage of certain membrane-bound substrates, including ephrin B2 and ephrin B3. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amn A C 12: 111,238,196 (GRCm39) N37H probably damaging Het
Apoa5 A T 9: 46,181,827 (GRCm39) D301V probably damaging Het
Atrn A G 2: 130,812,128 (GRCm39) E691G probably benign Het
Ccer1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 10: 97,530,232 (GRCm39) probably benign Het
Cct2 A G 10: 116,891,056 (GRCm39) V396A probably damaging Het
Dhx35 C T 2: 158,684,272 (GRCm39) Q516* probably null Het
Dop1b A G 16: 93,567,812 (GRCm39) K1413R probably benign Het
Dpp9 T C 17: 56,494,391 (GRCm39) H856R possibly damaging Het
Eif4e2 T C 1: 87,152,093 (GRCm39) F97L probably benign Het
Exoc6b A T 6: 84,980,161 (GRCm39) probably benign Het
Fat1 T A 8: 45,405,999 (GRCm39) S917T probably benign Het
Frem1 A T 4: 82,831,488 (GRCm39) Y2043N probably damaging Het
Galnt14 A G 17: 73,819,154 (GRCm39) I312T probably damaging Het
Glipr1 T C 10: 111,821,542 (GRCm39) N220S possibly damaging Het
Grid1 A G 14: 34,667,989 (GRCm39) E172G probably benign Het
Hspa4l C A 3: 40,721,241 (GRCm39) probably null Het
Il1rl2 G T 1: 40,390,951 (GRCm39) R298L probably benign Het
Il7r T A 15: 9,513,014 (GRCm39) H165L probably damaging Het
Krt87 T G 15: 101,385,395 (GRCm39) M326L probably benign Het
Lcn10 G T 2: 25,574,052 (GRCm39) C85F probably damaging Het
Mideas C T 12: 84,203,245 (GRCm39) G886S probably benign Het
Nup205 C A 6: 35,168,962 (GRCm39) P397Q probably benign Het
Or4d10 A G 19: 12,051,861 (GRCm39) V45A probably benign Het
Or4f17-ps1 G A 2: 111,357,985 (GRCm39) V127M probably benign Het
Or8b12c A T 9: 37,715,486 (GRCm39) H93L probably benign Het
Prkce C T 17: 86,784,279 (GRCm39) T218I probably damaging Het
Ripor2 C T 13: 24,905,694 (GRCm39) P947S probably benign Het
Shoc1 T G 4: 59,082,294 (GRCm39) T445P possibly damaging Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Sptbn5 A G 2: 119,899,136 (GRCm39) L428P probably damaging Het
Syne1 A G 10: 5,303,987 (GRCm39) V789A probably damaging Het
Taar8c C T 10: 23,977,477 (GRCm39) V112M probably benign Het
Tex10 T C 4: 48,468,774 (GRCm39) I51V probably benign Het
Ttll1 T A 15: 83,384,195 (GRCm39) Q144L probably damaging Het
Other mutations in Rhbdl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Rhbdl2 APN 4 123,723,450 (GRCm39) missense probably benign
IGL02111:Rhbdl2 APN 4 123,716,630 (GRCm39) missense probably damaging 1.00
IGL03381:Rhbdl2 APN 4 123,716,610 (GRCm39) missense possibly damaging 0.84
IGL03410:Rhbdl2 APN 4 123,723,463 (GRCm39) nonsense probably null
R0039:Rhbdl2 UTSW 4 123,703,822 (GRCm39) missense probably benign 0.02
R1292:Rhbdl2 UTSW 4 123,723,435 (GRCm39) missense possibly damaging 0.69
R2024:Rhbdl2 UTSW 4 123,720,665 (GRCm39) missense probably damaging 1.00
R2120:Rhbdl2 UTSW 4 123,718,712 (GRCm39) missense probably damaging 1.00
R4366:Rhbdl2 UTSW 4 123,703,728 (GRCm39) start codon destroyed probably null 0.87
R4413:Rhbdl2 UTSW 4 123,703,880 (GRCm39) missense probably benign 0.04
R4749:Rhbdl2 UTSW 4 123,720,694 (GRCm39) critical splice donor site probably null
R5069:Rhbdl2 UTSW 4 123,711,710 (GRCm39) nonsense probably null
R5303:Rhbdl2 UTSW 4 123,704,014 (GRCm39) intron probably benign
R5951:Rhbdl2 UTSW 4 123,708,120 (GRCm39) missense probably benign 0.00
R7147:Rhbdl2 UTSW 4 123,703,908 (GRCm39) missense probably damaging 1.00
R7171:Rhbdl2 UTSW 4 123,708,049 (GRCm39) missense possibly damaging 0.95
R7337:Rhbdl2 UTSW 4 123,711,659 (GRCm39) missense possibly damaging 0.91
R7374:Rhbdl2 UTSW 4 123,711,658 (GRCm39) missense probably benign 0.01
R7411:Rhbdl2 UTSW 4 123,723,435 (GRCm39) missense possibly damaging 0.69
R7718:Rhbdl2 UTSW 4 123,718,712 (GRCm39) missense probably damaging 1.00
R8152:Rhbdl2 UTSW 4 123,718,711 (GRCm39) missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ACCTGATCCAATTTGGGGCC -3'
(R):5'- ATGTTCTTCGGACTGGCTC -3'

Sequencing Primer
(F):5'- ATCCAATTTGGGGCCACTTG -3'
(R):5'- TCTTCGGACTGGCTCAGGAAG -3'
Posted On 2015-07-06