Incidental Mutation 'R4364:Rhbdl2'
ID325667
Institutional Source Beutler Lab
Gene Symbol Rhbdl2
Ensembl Gene ENSMUSG00000043333
Gene Namerhomboid like 2
Synonyms
MMRRC Submission 041672-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4364 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location123787874-123829904 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 123809935 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000101810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053202] [ENSMUST00000106204]
Predicted Effect probably null
Transcript: ENSMUST00000053202
AA Change: M1K

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000054546
Gene: ENSMUSG00000043333
AA Change: M1K

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Rhomboid 113 268 7.1e-39 PFAM
transmembrane domain 277 299 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106204
AA Change: M1K

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101810
Gene: ENSMUSG00000043333
AA Change: M1K

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Rhomboid 113 268 1.8e-38 PFAM
transmembrane domain 277 299 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150286
Meta Mutation Damage Score 0.9718 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 93% (40/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the rhomboid family of integral membrane proteins. This family contains proteins that are related to Drosophila rhomboid protein. Members of this family are found in both prokaryotes and eukaryotes and are thought to function as intramembrane serine proteases. The encoded protein is thought to release soluble growth factors by proteolytic cleavage of certain membrane-bound substrates, including ephrin B2 and ephrin B3. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 T G 4: 59,082,294 T445P possibly damaging Het
Amn A C 12: 111,271,762 N37H probably damaging Het
Apoa5 A T 9: 46,270,529 D301V probably damaging Het
Atrn A G 2: 130,970,208 E691G probably benign Het
Ccer1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 10: 97,694,370 probably benign Het
Cct2 A G 10: 117,055,151 V396A probably damaging Het
Dhx35 C T 2: 158,842,352 Q516* probably null Het
Dopey2 A G 16: 93,770,924 K1413R probably benign Het
Dpp9 T C 17: 56,187,391 H856R possibly damaging Het
Eif4e2 T C 1: 87,224,371 F97L probably benign Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Exoc6b A T 6: 85,003,179 probably benign Het
Fat1 T A 8: 44,952,962 S917T probably benign Het
Frem1 A T 4: 82,913,251 Y2043N probably damaging Het
Galnt14 A G 17: 73,512,159 I312T probably damaging Het
Glipr1 T C 10: 111,985,637 N220S possibly damaging Het
Grid1 A G 14: 34,946,032 E172G probably benign Het
Hspa4l C A 3: 40,766,809 probably null Het
Il1rl2 G T 1: 40,351,791 R298L probably benign Het
Il7r T A 15: 9,512,928 H165L probably damaging Het
Krt83 T G 15: 101,487,514 M326L probably benign Het
Lcn10 G T 2: 25,684,040 C85F probably damaging Het
Nup205 C A 6: 35,192,027 P397Q probably benign Het
Olfr1293-ps G A 2: 111,527,640 V127M probably benign Het
Olfr1425 A G 19: 12,074,497 V45A probably benign Het
Olfr876 A T 9: 37,804,190 H93L probably benign Het
Prkce C T 17: 86,476,851 T218I probably damaging Het
Ripor2 C T 13: 24,721,711 P947S probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sptbn5 A G 2: 120,068,655 L428P probably damaging Het
Syne1 A G 10: 5,353,987 V789A probably damaging Het
Taar8c C T 10: 24,101,579 V112M probably benign Het
Tex10 T C 4: 48,468,774 I51V probably benign Het
Ttll1 T A 15: 83,499,994 Q144L probably damaging Het
Other mutations in Rhbdl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Rhbdl2 APN 4 123829657 missense probably benign
IGL02111:Rhbdl2 APN 4 123822837 missense probably damaging 1.00
IGL03381:Rhbdl2 APN 4 123822817 missense possibly damaging 0.84
IGL03410:Rhbdl2 APN 4 123829670 nonsense probably null
R0039:Rhbdl2 UTSW 4 123810029 missense probably benign 0.02
R1292:Rhbdl2 UTSW 4 123829642 missense possibly damaging 0.69
R2024:Rhbdl2 UTSW 4 123826872 missense probably damaging 1.00
R2120:Rhbdl2 UTSW 4 123824919 missense probably damaging 1.00
R4366:Rhbdl2 UTSW 4 123809935 start codon destroyed probably null 0.87
R4413:Rhbdl2 UTSW 4 123810087 missense probably benign 0.04
R4749:Rhbdl2 UTSW 4 123826901 critical splice donor site probably null
R5069:Rhbdl2 UTSW 4 123817917 nonsense probably null
R5303:Rhbdl2 UTSW 4 123810221 intron probably benign
R5951:Rhbdl2 UTSW 4 123814327 missense probably benign 0.00
R7147:Rhbdl2 UTSW 4 123810115 missense probably damaging 1.00
R7171:Rhbdl2 UTSW 4 123814256 missense possibly damaging 0.95
R7337:Rhbdl2 UTSW 4 123817866 missense possibly damaging 0.91
R7374:Rhbdl2 UTSW 4 123817865 missense probably benign 0.01
R7411:Rhbdl2 UTSW 4 123829642 missense possibly damaging 0.69
R7718:Rhbdl2 UTSW 4 123824919 missense probably damaging 1.00
R8152:Rhbdl2 UTSW 4 123824918 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ACCTGATCCAATTTGGGGCC -3'
(R):5'- ATGTTCTTCGGACTGGCTC -3'

Sequencing Primer
(F):5'- ATCCAATTTGGGGCCACTTG -3'
(R):5'- TCTTCGGACTGGCTCAGGAAG -3'
Posted On2015-07-06