Incidental Mutation 'R4364:Olfr876'
ID325673
Institutional Source Beutler Lab
Gene Symbol Olfr876
Ensembl Gene ENSMUSG00000066750
Gene Nameolfactory receptor 876
SynonymsGA_x6K02T2PVTD-31489645-31490577, MOR161-1
MMRRC Submission 041672-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R4364 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location37803031-37808144 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37804190 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 93 (H93L)
Ref Sequence ENSEMBL: ENSMUSP00000149930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086064] [ENSMUST00000213368] [ENSMUST00000215287]
Predicted Effect probably benign
Transcript: ENSMUST00000086064
AA Change: H93L

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000083231
Gene: ENSMUSG00000066750
AA Change: H93L

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 1.6e-47 PFAM
Pfam:7tm_1 40 289 3.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213368
AA Change: H93L

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000215287
AA Change: H93L

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 93% (40/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 T G 4: 59,082,294 T445P possibly damaging Het
Amn A C 12: 111,271,762 N37H probably damaging Het
Apoa5 A T 9: 46,270,529 D301V probably damaging Het
Atrn A G 2: 130,970,208 E691G probably benign Het
Ccer1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 10: 97,694,370 probably benign Het
Cct2 A G 10: 117,055,151 V396A probably damaging Het
Dhx35 C T 2: 158,842,352 Q516* probably null Het
Dopey2 A G 16: 93,770,924 K1413R probably benign Het
Dpp9 T C 17: 56,187,391 H856R possibly damaging Het
Eif4e2 T C 1: 87,224,371 F97L probably benign Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Exoc6b A T 6: 85,003,179 probably benign Het
Fat1 T A 8: 44,952,962 S917T probably benign Het
Frem1 A T 4: 82,913,251 Y2043N probably damaging Het
Galnt14 A G 17: 73,512,159 I312T probably damaging Het
Glipr1 T C 10: 111,985,637 N220S possibly damaging Het
Grid1 A G 14: 34,946,032 E172G probably benign Het
Hspa4l C A 3: 40,766,809 probably null Het
Il1rl2 G T 1: 40,351,791 R298L probably benign Het
Il7r T A 15: 9,512,928 H165L probably damaging Het
Krt83 T G 15: 101,487,514 M326L probably benign Het
Lcn10 G T 2: 25,684,040 C85F probably damaging Het
Nup205 C A 6: 35,192,027 P397Q probably benign Het
Olfr1293-ps G A 2: 111,527,640 V127M probably benign Het
Olfr1425 A G 19: 12,074,497 V45A probably benign Het
Prkce C T 17: 86,476,851 T218I probably damaging Het
Rhbdl2 T A 4: 123,809,935 M1K probably null Het
Ripor2 C T 13: 24,721,711 P947S probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sptbn5 A G 2: 120,068,655 L428P probably damaging Het
Syne1 A G 10: 5,353,987 V789A probably damaging Het
Taar8c C T 10: 24,101,579 V112M probably benign Het
Tex10 T C 4: 48,468,774 I51V probably benign Het
Ttll1 T A 15: 83,499,994 Q144L probably damaging Het
Other mutations in Olfr876
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Olfr876 APN 9 37804782 missense probably damaging 1.00
IGL01330:Olfr876 APN 9 37804220 missense probably damaging 1.00
IGL02105:Olfr876 APN 9 37804595 missense possibly damaging 0.53
IGL02505:Olfr876 APN 9 37804331 missense probably benign 0.08
R1543:Olfr876 UTSW 9 37803947 missense possibly damaging 0.94
R1768:Olfr876 UTSW 9 37804303 missense probably damaging 1.00
R1960:Olfr876 UTSW 9 37803946 missense probably benign 0.01
R2567:Olfr876 UTSW 9 37804213 missense probably damaging 1.00
R3815:Olfr876 UTSW 9 37804169 missense probably benign 0.05
R3816:Olfr876 UTSW 9 37804169 missense probably benign 0.05
R3817:Olfr876 UTSW 9 37804169 missense probably benign 0.05
R3819:Olfr876 UTSW 9 37804169 missense probably benign 0.05
R4366:Olfr876 UTSW 9 37804190 missense probably benign 0.19
R4620:Olfr876 UTSW 9 37804819 missense probably benign 0.02
R5530:Olfr876 UTSW 9 37804807 missense probably benign 0.00
R6199:Olfr876 UTSW 9 37804881 utr 3 prime probably null
R6238:Olfr876 UTSW 9 37804021 missense probably benign 0.26
R6893:Olfr876 UTSW 9 37804845 makesense probably null
R7404:Olfr876 UTSW 9 37803961 missense possibly damaging 0.80
R7806:Olfr876 UTSW 9 37804576 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTTCATCCTTGCAGGCCTG -3'
(R):5'- GTCAGCCTTGCCATGGATATG -3'

Sequencing Primer
(F):5'- ATCCTTGCAGGCCTGACAGAC -3'
(R):5'- GGGCCATGGCTCCAACAAAAC -3'
Posted On2015-07-06