Incidental Mutation 'R4364:Apoa5'
ID325674
Institutional Source Beutler Lab
Gene Symbol Apoa5
Ensembl Gene ENSMUSG00000032079
Gene Nameapolipoprotein A-V
Synonyms1300007O05Rik, RAP3, Apoav
MMRRC Submission 041672-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4364 (G1)
Quality Score202
Status Validated
Chromosome9
Chromosomal Location46268633-46271919 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 46270529 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 301 (D301V)
Ref Sequence ENSEMBL: ENSMUSP00000113413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034584] [ENSMUST00000121598] [ENSMUST00000156440] [ENSMUST00000213878] [ENSMUST00000214202] [ENSMUST00000215187] [ENSMUST00000215458]
Predicted Effect probably damaging
Transcript: ENSMUST00000034584
AA Change: D301V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034584
Gene: ENSMUSG00000032079
AA Change: D301V

DomainStartEndE-ValueType
Pfam:Apolipoprotein 52 264 5.1e-59 PFAM
Pfam:Apolipoprotein 258 315 1.8e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114552
SMART Domains Protein: ENSMUSP00000110199
Gene: ENSMUSG00000032078

DomainStartEndE-ValueType
Zpr1 12 150 5.57e-30 SMART
Zpr1 184 343 4.27e-90 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121598
AA Change: D301V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113413
Gene: ENSMUSG00000032079
AA Change: D301V

DomainStartEndE-ValueType
Pfam:Apolipoprotein 51 305 8.1e-66 PFAM
low complexity region 312 323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125239
SMART Domains Protein: ENSMUSP00000123437
Gene: ENSMUSG00000032078

DomainStartEndE-ValueType
low complexity region 11 32 N/A INTRINSIC
Blast:Zpr1 33 59 2e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125791
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141763
Predicted Effect probably benign
Transcript: ENSMUST00000156440
SMART Domains Protein: ENSMUSP00000117725
Gene: ENSMUSG00000032078

DomainStartEndE-ValueType
low complexity region 9 30 N/A INTRINSIC
Zpr1 49 207 1.47e-93 SMART
low complexity region 236 246 N/A INTRINSIC
Zpr1 257 416 4.27e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213878
Predicted Effect probably benign
Transcript: ENSMUST00000214202
Predicted Effect probably benign
Transcript: ENSMUST00000215187
Predicted Effect probably benign
Transcript: ENSMUST00000215458
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215484
Meta Mutation Damage Score 0.1519 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 93% (40/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an apolipoprotein that plays an important role in regulating the plasma triglyceride levels, a major risk factor for coronary artery disease. It is a component of high density lipoprotein and is highly similar to a rat protein that is upregulated in response to liver injury. Mutations in this gene have been associated with hypertriglyceridemia and hyperlipoproteinemia type 5. This gene is located proximal to the apolipoprotein gene cluster on chromosome 11q23. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutation of this gene results in increased triglyceride and VLDL cholesterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 T G 4: 59,082,294 T445P possibly damaging Het
Amn A C 12: 111,271,762 N37H probably damaging Het
Atrn A G 2: 130,970,208 E691G probably benign Het
Ccer1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 10: 97,694,370 probably benign Het
Cct2 A G 10: 117,055,151 V396A probably damaging Het
Dhx35 C T 2: 158,842,352 Q516* probably null Het
Dopey2 A G 16: 93,770,924 K1413R probably benign Het
Dpp9 T C 17: 56,187,391 H856R possibly damaging Het
Eif4e2 T C 1: 87,224,371 F97L probably benign Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Exoc6b A T 6: 85,003,179 probably benign Het
Fat1 T A 8: 44,952,962 S917T probably benign Het
Frem1 A T 4: 82,913,251 Y2043N probably damaging Het
Galnt14 A G 17: 73,512,159 I312T probably damaging Het
Glipr1 T C 10: 111,985,637 N220S possibly damaging Het
Grid1 A G 14: 34,946,032 E172G probably benign Het
Hspa4l C A 3: 40,766,809 probably null Het
Il1rl2 G T 1: 40,351,791 R298L probably benign Het
Il7r T A 15: 9,512,928 H165L probably damaging Het
Krt83 T G 15: 101,487,514 M326L probably benign Het
Lcn10 G T 2: 25,684,040 C85F probably damaging Het
Nup205 C A 6: 35,192,027 P397Q probably benign Het
Olfr1293-ps G A 2: 111,527,640 V127M probably benign Het
Olfr1425 A G 19: 12,074,497 V45A probably benign Het
Olfr876 A T 9: 37,804,190 H93L probably benign Het
Prkce C T 17: 86,476,851 T218I probably damaging Het
Rhbdl2 T A 4: 123,809,935 M1K probably null Het
Ripor2 C T 13: 24,721,711 P947S probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sptbn5 A G 2: 120,068,655 L428P probably damaging Het
Syne1 A G 10: 5,353,987 V789A probably damaging Het
Taar8c C T 10: 24,101,579 V112M probably benign Het
Tex10 T C 4: 48,468,774 I51V probably benign Het
Ttll1 T A 15: 83,499,994 Q144L probably damaging Het
Other mutations in Apoa5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02084:Apoa5 APN 9 46270652 missense probably damaging 0.98
IGL02089:Apoa5 APN 9 46269139 critical splice donor site probably null
R0046:Apoa5 UTSW 9 46269998 missense probably damaging 1.00
R1722:Apoa5 UTSW 9 46270549 nonsense probably null
R2007:Apoa5 UTSW 9 46270367 missense possibly damaging 0.95
R2356:Apoa5 UTSW 9 46270043 missense probably damaging 0.98
R3739:Apoa5 UTSW 9 46269117 missense probably damaging 1.00
R3835:Apoa5 UTSW 9 46270580 missense probably damaging 1.00
R4657:Apoa5 UTSW 9 46269872 missense probably benign 0.12
R4760:Apoa5 UTSW 9 46270295 missense probably damaging 0.97
R5160:Apoa5 UTSW 9 46270496 missense probably damaging 0.99
R5523:Apoa5 UTSW 9 46270589 missense possibly damaging 0.79
R5915:Apoa5 UTSW 9 46269309 missense probably damaging 1.00
R6106:Apoa5 UTSW 9 46270633 nonsense probably null
R6849:Apoa5 UTSW 9 46270000 missense probably benign 0.03
R7170:Apoa5 UTSW 9 46270139 missense probably benign 0.00
Z1177:Apoa5 UTSW 9 46269119 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TCACACGTAAGGCGAAGGAC -3'
(R):5'- TCAGGGTCACTCAAATGACTATGAC -3'

Sequencing Primer
(F):5'- TAAGGCGAAGGACCTGCACAC -3'
(R):5'- ACTATGACCCTGGTCTTGAAGGC -3'
Posted On2015-07-06