Incidental Mutation 'R4364:Glipr1'
ID325677
Institutional Source Beutler Lab
Gene Symbol Glipr1
Ensembl Gene ENSMUSG00000056888
Gene NameGLI pathogenesis-related 1 (glioma)
SynonymsRTVP1, RTVP-1, 2410114O14Rik, mRTVP-1
MMRRC Submission 041672-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R4364 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location111985448-112002631 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111985637 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 220 (N220S)
Ref Sequence ENSEMBL: ENSMUSP00000123990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074805] [ENSMUST00000161870] [ENSMUST00000162508] [ENSMUST00000163048] [ENSMUST00000174653]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074805
AA Change: N220S

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000074359
Gene: ENSMUSG00000056888
AA Change: N220S

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SCP 32 172 4.04e-55 SMART
transmembrane domain 222 244 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000075924
Predicted Effect silent
Transcript: ENSMUST00000161870
SMART Domains Protein: ENSMUSP00000134094
Gene: ENSMUSG00000056888

DomainStartEndE-ValueType
Pfam:CAP 1 42 9.2e-10 PFAM
low complexity region 82 93 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162508
AA Change: N220S

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123990
Gene: ENSMUSG00000056888
AA Change: N220S

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SCP 32 172 4.04e-55 SMART
transmembrane domain 222 244 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163048
SMART Domains Protein: ENSMUSP00000125746
Gene: ENSMUSG00000063334

DomainStartEndE-ValueType
KH 138 210 4.85e-6 SMART
low complexity region 246 264 N/A INTRINSIC
low complexity region 322 334 N/A INTRINSIC
low complexity region 339 363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174653
SMART Domains Protein: ENSMUSP00000134408
Gene: ENSMUSG00000063334

DomainStartEndE-ValueType
KH 138 210 4.85e-6 SMART
low complexity region 265 277 N/A INTRINSIC
low complexity region 282 306 N/A INTRINSIC
Meta Mutation Damage Score 0.1709 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 93% (40/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with similarity to both the pathogenesis-related protein (PR) superfamily and the cysteine-rich secretory protein (CRISP) family. Increased expression of this gene is associated with myelomocytic differentiation in macrophage and decreased expression of this gene through gene methylation is associated with prostate cancer. The protein has proapoptotic activities in prostate and bladder cancer cells. This gene is a member of a cluster on chromosome 12 containing two other similar genes. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted inactivation of this gene renders mice more vulnerable to spontaneous tumorigenesis, leading to the formation of a wide spectrum of tumors and significantly shorter tumor-free survival times. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 T G 4: 59,082,294 T445P possibly damaging Het
Amn A C 12: 111,271,762 N37H probably damaging Het
Apoa5 A T 9: 46,270,529 D301V probably damaging Het
Atrn A G 2: 130,970,208 E691G probably benign Het
Ccer1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 10: 97,694,370 probably benign Het
Cct2 A G 10: 117,055,151 V396A probably damaging Het
Dhx35 C T 2: 158,842,352 Q516* probably null Het
Dopey2 A G 16: 93,770,924 K1413R probably benign Het
Dpp9 T C 17: 56,187,391 H856R possibly damaging Het
Eif4e2 T C 1: 87,224,371 F97L probably benign Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Exoc6b A T 6: 85,003,179 probably benign Het
Fat1 T A 8: 44,952,962 S917T probably benign Het
Frem1 A T 4: 82,913,251 Y2043N probably damaging Het
Galnt14 A G 17: 73,512,159 I312T probably damaging Het
Grid1 A G 14: 34,946,032 E172G probably benign Het
Hspa4l C A 3: 40,766,809 probably null Het
Il1rl2 G T 1: 40,351,791 R298L probably benign Het
Il7r T A 15: 9,512,928 H165L probably damaging Het
Krt83 T G 15: 101,487,514 M326L probably benign Het
Lcn10 G T 2: 25,684,040 C85F probably damaging Het
Nup205 C A 6: 35,192,027 P397Q probably benign Het
Olfr1293-ps G A 2: 111,527,640 V127M probably benign Het
Olfr1425 A G 19: 12,074,497 V45A probably benign Het
Olfr876 A T 9: 37,804,190 H93L probably benign Het
Prkce C T 17: 86,476,851 T218I probably damaging Het
Rhbdl2 T A 4: 123,809,935 M1K probably null Het
Ripor2 C T 13: 24,721,711 P947S probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sptbn5 A G 2: 120,068,655 L428P probably damaging Het
Syne1 A G 10: 5,353,987 V789A probably damaging Het
Taar8c C T 10: 24,101,579 V112M probably benign Het
Tex10 T C 4: 48,468,774 I51V probably benign Het
Ttll1 T A 15: 83,499,994 Q144L probably damaging Het
Other mutations in Glipr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Glipr1 APN 10 111985650 missense probably benign
IGL00553:Glipr1 APN 10 111986669 missense possibly damaging 0.79
IGL02391:Glipr1 APN 10 111988894 unclassified probably benign
R0115:Glipr1 UTSW 10 111993541 missense probably benign 0.00
R0486:Glipr1 UTSW 10 111996849 splice site probably benign
R1349:Glipr1 UTSW 10 111993532 missense probably benign 0.02
R1822:Glipr1 UTSW 10 111996860 missense possibly damaging 0.84
R4905:Glipr1 UTSW 10 111985640 missense probably damaging 1.00
R4974:Glipr1 UTSW 10 111993506 nonsense probably null
R5734:Glipr1 UTSW 10 111985793 nonsense probably null
R7603:Glipr1 UTSW 10 111988832 missense probably benign 0.07
R8238:Glipr1 UTSW 10 111993440 critical splice donor site probably null
Z1176:Glipr1 UTSW 10 111988837 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TGCCGAAAGACAAGTTAACTCTG -3'
(R):5'- CTGGTTTTACAGTTAACCCACGAC -3'

Sequencing Primer
(F):5'- CGAAAGACAAGTTAACTCTGTAGAC -3'
(R):5'- GTTTTACAGTTAACCCACGACGAGAC -3'
Posted On2015-07-06