Incidental Mutation 'R4364:Cct2'
ID325678
Institutional Source Beutler Lab
Gene Symbol Cct2
Ensembl Gene ENSMUSG00000034024
Gene Namechaperonin containing Tcp1, subunit 2 (beta)
SynonymsCctb
MMRRC Submission 041672-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R4364 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location117051001-117063814 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117055151 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 396 (V396A)
Ref Sequence ENSEMBL: ENSMUSP00000036288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047672]
Predicted Effect probably damaging
Transcript: ENSMUST00000047672
AA Change: V396A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036288
Gene: ENSMUSG00000034024
AA Change: V396A

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 35 525 3.2e-150 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218502
Predicted Effect probably benign
Transcript: ENSMUST00000219690
Meta Mutation Damage Score 0.4774 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 93% (40/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 T G 4: 59,082,294 T445P possibly damaging Het
Amn A C 12: 111,271,762 N37H probably damaging Het
Apoa5 A T 9: 46,270,529 D301V probably damaging Het
Atrn A G 2: 130,970,208 E691G probably benign Het
Ccer1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 10: 97,694,370 probably benign Het
Dhx35 C T 2: 158,842,352 Q516* probably null Het
Dopey2 A G 16: 93,770,924 K1413R probably benign Het
Dpp9 T C 17: 56,187,391 H856R possibly damaging Het
Eif4e2 T C 1: 87,224,371 F97L probably benign Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Exoc6b A T 6: 85,003,179 probably benign Het
Fat1 T A 8: 44,952,962 S917T probably benign Het
Frem1 A T 4: 82,913,251 Y2043N probably damaging Het
Galnt14 A G 17: 73,512,159 I312T probably damaging Het
Glipr1 T C 10: 111,985,637 N220S possibly damaging Het
Grid1 A G 14: 34,946,032 E172G probably benign Het
Hspa4l C A 3: 40,766,809 probably null Het
Il1rl2 G T 1: 40,351,791 R298L probably benign Het
Il7r T A 15: 9,512,928 H165L probably damaging Het
Krt83 T G 15: 101,487,514 M326L probably benign Het
Lcn10 G T 2: 25,684,040 C85F probably damaging Het
Nup205 C A 6: 35,192,027 P397Q probably benign Het
Olfr1293-ps G A 2: 111,527,640 V127M probably benign Het
Olfr1425 A G 19: 12,074,497 V45A probably benign Het
Olfr876 A T 9: 37,804,190 H93L probably benign Het
Prkce C T 17: 86,476,851 T218I probably damaging Het
Rhbdl2 T A 4: 123,809,935 M1K probably null Het
Ripor2 C T 13: 24,721,711 P947S probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sptbn5 A G 2: 120,068,655 L428P probably damaging Het
Syne1 A G 10: 5,353,987 V789A probably damaging Het
Taar8c C T 10: 24,101,579 V112M probably benign Het
Tex10 T C 4: 48,468,774 I51V probably benign Het
Ttll1 T A 15: 83,499,994 Q144L probably damaging Het
Other mutations in Cct2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02111:Cct2 APN 10 117053112 missense probably damaging 0.99
IGL02150:Cct2 APN 10 117062099 missense probably damaging 0.99
IGL02349:Cct2 APN 10 117053139 missense probably benign 0.04
IGL03010:Cct2 APN 10 117058114 missense probably damaging 1.00
IGL03155:Cct2 APN 10 117060671 missense probably damaging 0.99
R0507:Cct2 UTSW 10 117055246 splice site probably null
R0742:Cct2 UTSW 10 117055246 splice site probably null
R1102:Cct2 UTSW 10 117060640 unclassified probably null
R1438:Cct2 UTSW 10 117054992 unclassified probably benign
R2040:Cct2 UTSW 10 117053113 missense probably benign 0.00
R2157:Cct2 UTSW 10 117062809 splice site probably benign
R2227:Cct2 UTSW 10 117053017 missense probably null 0.18
R3410:Cct2 UTSW 10 117062063 missense probably benign 0.01
R3981:Cct2 UTSW 10 117054135 missense probably damaging 1.00
R3983:Cct2 UTSW 10 117054135 missense probably damaging 1.00
R4401:Cct2 UTSW 10 117057809 missense possibly damaging 0.61
R6162:Cct2 UTSW 10 117058186 missense probably damaging 0.99
R6300:Cct2 UTSW 10 117056159 missense probably damaging 0.96
R6312:Cct2 UTSW 10 117056055 missense probably benign 0.00
R7075:Cct2 UTSW 10 117061465 missense unknown
R7198:Cct2 UTSW 10 117053124 missense probably benign
R7236:Cct2 UTSW 10 117061559 missense probably benign 0.00
R8373:Cct2 UTSW 10 117060824 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ATCAGCATCTCAGAGCAGCC -3'
(R):5'- TTTTGCAGAGAAGCATTGCTACC -3'

Sequencing Primer
(F):5'- TCTCAGAGCAGCCTACAAATG -3'
(R):5'- CAAAGCCCAAGACTAGTCGAG -3'
Posted On2015-07-06