Incidental Mutation 'R4364:Elmsan1'
ID325679
Institutional Source Beutler Lab
Gene Symbol Elmsan1
Ensembl Gene ENSMUSG00000042507
Gene NameELM2 and Myb/SANT-like domain containing 1
Synonyms9430029N19Rik, C130039O16Rik
MMRRC Submission 041672-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.457) question?
Stock #R4364 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location84149176-84218881 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 84156471 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 886 (G886S)
Ref Sequence ENSEMBL: ENSMUSP00000105923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046266] [ENSMUST00000110294] [ENSMUST00000220974]
Predicted Effect probably benign
Transcript: ENSMUST00000046266
AA Change: G886S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000048120
Gene: ENSMUSG00000042507
AA Change: G886S

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 107 117 N/A INTRINSIC
low complexity region 124 132 N/A INTRINSIC
low complexity region 247 265 N/A INTRINSIC
low complexity region 377 388 N/A INTRINSIC
low complexity region 556 567 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
ELM2 715 772 6.76e-14 SMART
low complexity region 798 814 N/A INTRINSIC
SANT 821 869 1.44e-5 SMART
low complexity region 906 926 N/A INTRINSIC
low complexity region 942 956 N/A INTRINSIC
ZnF_C2H2 1030 1052 4.72e-2 SMART
low complexity region 1053 1082 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110294
AA Change: G886S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105923
Gene: ENSMUSG00000042507
AA Change: G886S

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 107 117 N/A INTRINSIC
low complexity region 124 132 N/A INTRINSIC
low complexity region 247 265 N/A INTRINSIC
low complexity region 377 388 N/A INTRINSIC
low complexity region 556 567 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
ELM2 715 772 6.76e-14 SMART
low complexity region 798 814 N/A INTRINSIC
SANT 821 869 1.44e-5 SMART
low complexity region 906 926 N/A INTRINSIC
low complexity region 942 956 N/A INTRINSIC
ZnF_C2H2 1030 1052 4.72e-2 SMART
low complexity region 1053 1082 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137562
Predicted Effect probably benign
Transcript: ENSMUST00000220974
AA Change: G886S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 93% (40/43)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 T G 4: 59,082,294 T445P possibly damaging Het
Amn A C 12: 111,271,762 N37H probably damaging Het
Apoa5 A T 9: 46,270,529 D301V probably damaging Het
Atrn A G 2: 130,970,208 E691G probably benign Het
Ccer1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 10: 97,694,370 probably benign Het
Cct2 A G 10: 117,055,151 V396A probably damaging Het
Dhx35 C T 2: 158,842,352 Q516* probably null Het
Dopey2 A G 16: 93,770,924 K1413R probably benign Het
Dpp9 T C 17: 56,187,391 H856R possibly damaging Het
Eif4e2 T C 1: 87,224,371 F97L probably benign Het
Exoc6b A T 6: 85,003,179 probably benign Het
Fat1 T A 8: 44,952,962 S917T probably benign Het
Frem1 A T 4: 82,913,251 Y2043N probably damaging Het
Galnt14 A G 17: 73,512,159 I312T probably damaging Het
Glipr1 T C 10: 111,985,637 N220S possibly damaging Het
Grid1 A G 14: 34,946,032 E172G probably benign Het
Hspa4l C A 3: 40,766,809 probably null Het
Il1rl2 G T 1: 40,351,791 R298L probably benign Het
Il7r T A 15: 9,512,928 H165L probably damaging Het
Krt83 T G 15: 101,487,514 M326L probably benign Het
Lcn10 G T 2: 25,684,040 C85F probably damaging Het
Nup205 C A 6: 35,192,027 P397Q probably benign Het
Olfr1293-ps G A 2: 111,527,640 V127M probably benign Het
Olfr1425 A G 19: 12,074,497 V45A probably benign Het
Olfr876 A T 9: 37,804,190 H93L probably benign Het
Prkce C T 17: 86,476,851 T218I probably damaging Het
Rhbdl2 T A 4: 123,809,935 M1K probably null Het
Ripor2 C T 13: 24,721,711 P947S probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sptbn5 A G 2: 120,068,655 L428P probably damaging Het
Syne1 A G 10: 5,353,987 V789A probably damaging Het
Taar8c C T 10: 24,101,579 V112M probably benign Het
Tex10 T C 4: 48,468,774 I51V probably benign Het
Ttll1 T A 15: 83,499,994 Q144L probably damaging Het
Other mutations in Elmsan1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Elmsan1 APN 12 84172855 nonsense probably null
IGL00913:Elmsan1 APN 12 84172858 missense probably benign
IGL00944:Elmsan1 APN 12 84160548 splice site probably benign
IGL01108:Elmsan1 APN 12 84173691 missense probably damaging 1.00
IGL01952:Elmsan1 APN 12 84173266 missense probably benign 0.00
IGL01961:Elmsan1 APN 12 84173614 missense probably damaging 1.00
IGL02188:Elmsan1 APN 12 84162326 missense probably benign 0.00
IGL02700:Elmsan1 APN 12 84152862 missense probably benign 0.06
R0645:Elmsan1 UTSW 12 84158303 missense possibly damaging 0.71
R1387:Elmsan1 UTSW 12 84152931 missense probably damaging 0.98
R1740:Elmsan1 UTSW 12 84172902 missense probably damaging 0.99
R1769:Elmsan1 UTSW 12 84158350 splice site probably benign
R1795:Elmsan1 UTSW 12 84158974 critical splice donor site probably null
R2146:Elmsan1 UTSW 12 84173035 missense probably damaging 0.99
R2872:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R2872:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R2940:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R3408:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R3689:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R3691:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R3840:Elmsan1 UTSW 12 84171609 missense probably damaging 0.99
R4366:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R4392:Elmsan1 UTSW 12 84173111 missense probably benign 0.10
R4439:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R4440:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R4496:Elmsan1 UTSW 12 84156471 missense probably benign 0.00
R5227:Elmsan1 UTSW 12 84152887 missense probably benign 0.10
R6921:Elmsan1 UTSW 12 84156459 missense probably damaging 0.99
R7675:Elmsan1 UTSW 12 84173800 missense probably damaging 1.00
Z1176:Elmsan1 UTSW 12 84173499 missense probably damaging 0.99
Z1176:Elmsan1 UTSW 12 84173501 missense probably damaging 0.98
Z1177:Elmsan1 UTSW 12 84152991 missense probably benign 0.01
Z1177:Elmsan1 UTSW 12 84162358 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTTCAGCATCAGCACCATC -3'
(R):5'- CCTAAGGCTTAAAGGGAACGTG -3'

Sequencing Primer
(F):5'- TCGATACCGGAGAGAGCTC -3'
(R):5'- CTAAGGCTTAAAGGGAACGTGAAGAG -3'
Posted On2015-07-06