Incidental Mutation 'R4364:Grid1'
ID325682
Institutional Source Beutler Lab
Gene Symbol Grid1
Ensembl Gene ENSMUSG00000041078
Gene Nameglutamate receptor, ionotropic, delta 1
SynonymsGluRdelta1
MMRRC Submission 041672-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R4364 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location34820108-35583379 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34946032 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 172 (E172G)
Ref Sequence ENSEMBL: ENSMUSP00000044009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043349]
Predicted Effect probably benign
Transcript: ENSMUST00000043349
AA Change: E172G

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000044009
Gene: ENSMUSG00000041078
AA Change: E172G

DomainStartEndE-ValueType
Pfam:ANF_receptor 36 400 4.1e-51 PFAM
PBPe 438 807 4.68e-110 SMART
Lig_chan-Glu_bd 448 510 8.18e-25 SMART
low complexity region 838 853 N/A INTRINSIC
low complexity region 943 958 N/A INTRINSIC
Meta Mutation Damage Score 0.1417 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 93% (40/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of glutamate receptor channels. These channels mediate most of the fast excitatory synaptic transmission in the central nervous system and play key roles in synaptic plasticity.[provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygotes for a targeted null mutation display a significant high-frequency hearing loss, associated with reductions of both cochlear outer hair cell function and endolymphatic potential, as well as increased vulnerability to acoustic injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 T G 4: 59,082,294 T445P possibly damaging Het
Amn A C 12: 111,271,762 N37H probably damaging Het
Apoa5 A T 9: 46,270,529 D301V probably damaging Het
Atrn A G 2: 130,970,208 E691G probably benign Het
Ccer1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 10: 97,694,370 probably benign Het
Cct2 A G 10: 117,055,151 V396A probably damaging Het
Dhx35 C T 2: 158,842,352 Q516* probably null Het
Dopey2 A G 16: 93,770,924 K1413R probably benign Het
Dpp9 T C 17: 56,187,391 H856R possibly damaging Het
Eif4e2 T C 1: 87,224,371 F97L probably benign Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Exoc6b A T 6: 85,003,179 probably benign Het
Fat1 T A 8: 44,952,962 S917T probably benign Het
Frem1 A T 4: 82,913,251 Y2043N probably damaging Het
Galnt14 A G 17: 73,512,159 I312T probably damaging Het
Glipr1 T C 10: 111,985,637 N220S possibly damaging Het
Hspa4l C A 3: 40,766,809 probably null Het
Il1rl2 G T 1: 40,351,791 R298L probably benign Het
Il7r T A 15: 9,512,928 H165L probably damaging Het
Krt83 T G 15: 101,487,514 M326L probably benign Het
Lcn10 G T 2: 25,684,040 C85F probably damaging Het
Nup205 C A 6: 35,192,027 P397Q probably benign Het
Olfr1293-ps G A 2: 111,527,640 V127M probably benign Het
Olfr1425 A G 19: 12,074,497 V45A probably benign Het
Olfr876 A T 9: 37,804,190 H93L probably benign Het
Prkce C T 17: 86,476,851 T218I probably damaging Het
Rhbdl2 T A 4: 123,809,935 M1K probably null Het
Ripor2 C T 13: 24,721,711 P947S probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sptbn5 A G 2: 120,068,655 L428P probably damaging Het
Syne1 A G 10: 5,353,987 V789A probably damaging Het
Taar8c C T 10: 24,101,579 V112M probably benign Het
Tex10 T C 4: 48,468,774 I51V probably benign Het
Ttll1 T A 15: 83,499,994 Q144L probably damaging Het
Other mutations in Grid1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Grid1 APN 14 35445887 missense possibly damaging 0.70
IGL01016:Grid1 APN 14 34822639 nonsense probably null
IGL01643:Grid1 APN 14 35323435 critical splice donor site probably null
IGL01697:Grid1 APN 14 35309257 missense probably benign 0.21
IGL01879:Grid1 APN 14 35450370 missense possibly damaging 0.93
IGL01975:Grid1 APN 14 35323426 missense probably benign
IGL02515:Grid1 APN 14 35452345 missense probably damaging 0.99
IGL02935:Grid1 APN 14 34822558 missense possibly damaging 0.86
IGL03279:Grid1 APN 14 34945765 missense probably damaging 0.98
IGL03286:Grid1 APN 14 35520685 splice site probably benign
IGL03296:Grid1 APN 14 35580567 missense possibly damaging 0.52
IGL03305:Grid1 APN 14 35251707 missense probably damaging 1.00
R0533:Grid1 UTSW 14 35309385 missense possibly damaging 0.84
R0746:Grid1 UTSW 14 34822690 missense possibly damaging 0.92
R0811:Grid1 UTSW 14 34822619 missense probably benign
R0812:Grid1 UTSW 14 34822619 missense probably benign
R1144:Grid1 UTSW 14 35562676 splice site probably benign
R1217:Grid1 UTSW 14 34820229 start codon destroyed probably null 0.53
R1485:Grid1 UTSW 14 34822583 missense probably damaging 1.00
R1529:Grid1 UTSW 14 35309293 missense probably benign 0.36
R1606:Grid1 UTSW 14 35445965 missense probably damaging 0.96
R1691:Grid1 UTSW 14 35452329 missense probably damaging 1.00
R1759:Grid1 UTSW 14 35446031 missense possibly damaging 0.92
R2374:Grid1 UTSW 14 35321807 splice site probably benign
R2415:Grid1 UTSW 14 35450369 missense possibly damaging 0.69
R2866:Grid1 UTSW 14 35562559 missense probably damaging 1.00
R3915:Grid1 UTSW 14 35520727 missense probably damaging 1.00
R4044:Grid1 UTSW 14 35450401 splice site probably benign
R4691:Grid1 UTSW 14 35569557 missense probably benign
R4694:Grid1 UTSW 14 35026780 missense probably damaging 1.00
R4749:Grid1 UTSW 14 35580687 missense possibly damaging 0.50
R4794:Grid1 UTSW 14 34822622 missense probably damaging 0.99
R4854:Grid1 UTSW 14 35321641 missense probably benign
R5555:Grid1 UTSW 14 35520705 missense possibly damaging 0.92
R6005:Grid1 UTSW 14 35323412 missense probably damaging 1.00
R6176:Grid1 UTSW 14 35562547 missense probably benign 0.00
R6569:Grid1 UTSW 14 35323339 missense possibly damaging 0.72
R6911:Grid1 UTSW 14 34820228 start codon destroyed probably benign 0.08
R7504:Grid1 UTSW 14 35562513 missense probably damaging 1.00
R7744:Grid1 UTSW 14 35450079 missense probably damaging 1.00
R7795:Grid1 UTSW 14 35321685 missense probably damaging 1.00
R7883:Grid1 UTSW 14 35450302 synonymous probably null
R7913:Grid1 UTSW 14 35569697 missense probably damaging 0.99
R8032:Grid1 UTSW 14 35323359 missense probably benign 0.00
R8333:Grid1 UTSW 14 35569638 missense possibly damaging 0.82
U24488:Grid1 UTSW 14 35580577 missense probably benign 0.00
Z1088:Grid1 UTSW 14 35452294 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATTTTGGCCTTGGTCACATCC -3'
(R):5'- ATTCACAAAGCTCAAGGTTGGG -3'

Sequencing Primer
(F):5'- TTGGTCACATCCACGGGCTG -3'
(R):5'- TCAAGGTTGGGCCCTACC -3'
Posted On2015-07-06