Incidental Mutation 'R4364:Il7r'
ID325683
Institutional Source Beutler Lab
Gene Symbol Il7r
Ensembl Gene ENSMUSG00000003882
Gene Nameinterleukin 7 receptor
SynonymsIL-7 receptor alpha chain, CD127, IL-7Ralpha
MMRRC Submission 041672-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R4364 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location9505788-9530176 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 9512928 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 165 (H165L)
Ref Sequence ENSEMBL: ENSMUSP00000154530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003981] [ENSMUST00000228782]
Predicted Effect probably damaging
Transcript: ENSMUST00000003981
AA Change: H165L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003981
Gene: ENSMUSG00000003882
AA Change: H165L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 25 37 N/A INTRINSIC
FN3 129 216 1.09e1 SMART
transmembrane domain 241 263 N/A INTRINSIC
low complexity region 413 422 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227234
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228673
Predicted Effect probably damaging
Transcript: ENSMUST00000228782
AA Change: H165L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.7305 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 93% (40/43)
MGI Phenotype FUNCTION: Interleukin-7 is a glycoptorein involved in the regulation of lymphopoiesis. Response of cells to IL7 is dependent on the presence of the interleukin 7 receptor (IL7R); the active receptor is a alpha/gamma chain heterodimer. The gamma(c) chain, which also associates with the interleukin-2 receptor, serves primarily to activate signal transduction by the IL7R complex, while the alpha chain of IL7R determines specific signaling events through its association with cytoplasmic signaling molecules. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutations cause arrested T and B cell differentiation and severely reduced thymus and spleen cellularity. Mice homozygous for a knock-in allele show partial rescue of T cell numbers during late thymus development, and impaired CD8 T cell memory and CD4 T cell primary responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 T G 4: 59,082,294 T445P possibly damaging Het
Amn A C 12: 111,271,762 N37H probably damaging Het
Apoa5 A T 9: 46,270,529 D301V probably damaging Het
Atrn A G 2: 130,970,208 E691G probably benign Het
Ccer1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 10: 97,694,370 probably benign Het
Cct2 A G 10: 117,055,151 V396A probably damaging Het
Dhx35 C T 2: 158,842,352 Q516* probably null Het
Dopey2 A G 16: 93,770,924 K1413R probably benign Het
Dpp9 T C 17: 56,187,391 H856R possibly damaging Het
Eif4e2 T C 1: 87,224,371 F97L probably benign Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Exoc6b A T 6: 85,003,179 probably benign Het
Fat1 T A 8: 44,952,962 S917T probably benign Het
Frem1 A T 4: 82,913,251 Y2043N probably damaging Het
Galnt14 A G 17: 73,512,159 I312T probably damaging Het
Glipr1 T C 10: 111,985,637 N220S possibly damaging Het
Grid1 A G 14: 34,946,032 E172G probably benign Het
Hspa4l C A 3: 40,766,809 probably null Het
Il1rl2 G T 1: 40,351,791 R298L probably benign Het
Krt83 T G 15: 101,487,514 M326L probably benign Het
Lcn10 G T 2: 25,684,040 C85F probably damaging Het
Nup205 C A 6: 35,192,027 P397Q probably benign Het
Olfr1293-ps G A 2: 111,527,640 V127M probably benign Het
Olfr1425 A G 19: 12,074,497 V45A probably benign Het
Olfr876 A T 9: 37,804,190 H93L probably benign Het
Prkce C T 17: 86,476,851 T218I probably damaging Het
Rhbdl2 T A 4: 123,809,935 M1K probably null Het
Ripor2 C T 13: 24,721,711 P947S probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sptbn5 A G 2: 120,068,655 L428P probably damaging Het
Syne1 A G 10: 5,353,987 V789A probably damaging Het
Taar8c C T 10: 24,101,579 V112M probably benign Het
Tex10 T C 4: 48,468,774 I51V probably benign Het
Ttll1 T A 15: 83,499,994 Q144L probably damaging Het
Other mutations in Il7r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00800:Il7r APN 15 9525109 missense probably damaging 1.00
IGL01016:Il7r APN 15 9510208 missense probably damaging 0.98
IGL01094:Il7r APN 15 9507999 missense possibly damaging 0.94
IGL01406:Il7r APN 15 9508214 nonsense probably null
IGL02135:Il7r APN 15 9508006 missense probably benign 0.11
IGL02642:Il7r APN 15 9513047 splice site probably benign
happy UTSW 15 9508187 missense probably benign
R0278:Il7r UTSW 15 9516337 missense probably damaging 0.98
R0322:Il7r UTSW 15 9510215 missense probably benign 0.14
R1075:Il7r UTSW 15 9516457 missense probably benign 0.03
R4451:Il7r UTSW 15 9512948 missense probably benign 0.13
R5527:Il7r UTSW 15 9512924 missense probably benign 0.21
R5575:Il7r UTSW 15 9508187 missense probably benign
R6949:Il7r UTSW 15 9508004 missense probably damaging 1.00
R7479:Il7r UTSW 15 9513031 missense probably damaging 1.00
R7533:Il7r UTSW 15 9507961 missense probably benign 0.02
R7682:Il7r UTSW 15 9512927 missense probably damaging 1.00
R8394:Il7r UTSW 15 9516418 missense probably damaging 1.00
Z1177:Il7r UTSW 15 9508057 missense probably benign 0.04
Z1177:Il7r UTSW 15 9510229 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCAAGAAAGATGCAGGAGATTT -3'
(R):5'- TGGGTTTCAGAGAAGAAGGACT -3'

Sequencing Primer
(F):5'- AGATGCAGGAGATTTGGGGTCC -3'
(R):5'- GGACTTTAAAACGTGTAGTTATCAGC -3'
Posted On2015-07-06