Incidental Mutation 'R4364:Krt83'
ID325685
Institutional Source Beutler Lab
Gene Symbol Krt83
Ensembl Gene ENSMUSG00000047641
Gene Namekeratin 83
SynonymsKrt2-25
MMRRC Submission 041672-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R4364 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location101431490-101438804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 101487514 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 326 (M326L)
Ref Sequence ENSEMBL: ENSMUSP00000023718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023718]
Predicted Effect probably benign
Transcript: ENSMUST00000023718
AA Change: M326L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023718
Gene: ENSMUSG00000067613
AA Change: M326L

DomainStartEndE-ValueType
Pfam:Keratin_2_head 2 100 5.9e-16 PFAM
Filament 103 414 7.02e-149 SMART
low complexity region 422 436 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230173
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 93% (40/43)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 T G 4: 59,082,294 T445P possibly damaging Het
Amn A C 12: 111,271,762 N37H probably damaging Het
Apoa5 A T 9: 46,270,529 D301V probably damaging Het
Atrn A G 2: 130,970,208 E691G probably benign Het
Ccer1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 10: 97,694,370 probably benign Het
Cct2 A G 10: 117,055,151 V396A probably damaging Het
Dhx35 C T 2: 158,842,352 Q516* probably null Het
Dopey2 A G 16: 93,770,924 K1413R probably benign Het
Dpp9 T C 17: 56,187,391 H856R possibly damaging Het
Eif4e2 T C 1: 87,224,371 F97L probably benign Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Exoc6b A T 6: 85,003,179 probably benign Het
Fat1 T A 8: 44,952,962 S917T probably benign Het
Frem1 A T 4: 82,913,251 Y2043N probably damaging Het
Galnt14 A G 17: 73,512,159 I312T probably damaging Het
Glipr1 T C 10: 111,985,637 N220S possibly damaging Het
Grid1 A G 14: 34,946,032 E172G probably benign Het
Hspa4l C A 3: 40,766,809 probably null Het
Il1rl2 G T 1: 40,351,791 R298L probably benign Het
Il7r T A 15: 9,512,928 H165L probably damaging Het
Lcn10 G T 2: 25,684,040 C85F probably damaging Het
Nup205 C A 6: 35,192,027 P397Q probably benign Het
Olfr1293-ps G A 2: 111,527,640 V127M probably benign Het
Olfr1425 A G 19: 12,074,497 V45A probably benign Het
Olfr876 A T 9: 37,804,190 H93L probably benign Het
Prkce C T 17: 86,476,851 T218I probably damaging Het
Rhbdl2 T A 4: 123,809,935 M1K probably null Het
Ripor2 C T 13: 24,721,711 P947S probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sptbn5 A G 2: 120,068,655 L428P probably damaging Het
Syne1 A G 10: 5,353,987 V789A probably damaging Het
Taar8c C T 10: 24,101,579 V112M probably benign Het
Tex10 T C 4: 48,468,774 I51V probably benign Het
Ttll1 T A 15: 83,499,994 Q144L probably damaging Het
Other mutations in Krt83
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Krt83 APN 15 101488211 missense probably benign 0.17
IGL01315:Krt83 APN 15 101486967 splice site probably benign
IGL01702:Krt83 APN 15 101491218 missense probably benign 0.18
IGL02123:Krt83 APN 15 101487585 missense possibly damaging 0.49
IGL02353:Krt83 APN 15 101485458 missense probably benign
IGL02360:Krt83 APN 15 101485458 missense probably benign
IGL02395:Krt83 APN 15 101487952 missense probably benign 0.18
IGL02633:Krt83 APN 15 101491214 missense probably damaging 1.00
R0357:Krt83 UTSW 15 101487019 missense probably benign 0.17
R0650:Krt83 UTSW 15 101487040 missense probably damaging 0.99
R0928:Krt83 UTSW 15 101491280 missense probably benign 0.00
R1126:Krt83 UTSW 15 101487482 missense probably damaging 0.98
R1196:Krt83 UTSW 15 101491433 missense probably benign 0.03
R1252:Krt83 UTSW 15 101487830 missense probably damaging 1.00
R1513:Krt83 UTSW 15 101489657 missense probably benign 0.30
R1612:Krt83 UTSW 15 101488211 missense probably benign 0.17
R1870:Krt83 UTSW 15 101487190 missense probably benign
R2173:Krt83 UTSW 15 101487937 missense probably damaging 0.98
R2432:Krt83 UTSW 15 101488156 nonsense probably null
R2568:Krt83 UTSW 15 101487827 missense possibly damaging 0.67
R2696:Krt83 UTSW 15 101487009 missense probably benign 0.01
R3508:Krt83 UTSW 15 101488158 missense probably benign 0.04
R4366:Krt83 UTSW 15 101487514 missense probably benign
R4606:Krt83 UTSW 15 101487049 missense probably benign 0.18
R4721:Krt83 UTSW 15 101487982 missense probably damaging 1.00
R4784:Krt83 UTSW 15 101487956 missense probably damaging 1.00
R4987:Krt83 UTSW 15 101487009 missense probably benign
R5008:Krt83 UTSW 15 101491224 missense probably damaging 1.00
R5101:Krt83 UTSW 15 101487510 missense probably benign 0.14
R5367:Krt83 UTSW 15 101486994 missense probably damaging 1.00
R5516:Krt83 UTSW 15 101487121 nonsense probably null
R5949:Krt83 UTSW 15 101487595 missense probably damaging 0.99
R5972:Krt83 UTSW 15 101487586 missense probably benign
R6036:Krt83 UTSW 15 101487531 missense possibly damaging 0.78
R6036:Krt83 UTSW 15 101487531 missense possibly damaging 0.78
R6135:Krt83 UTSW 15 101487534 missense probably damaging 1.00
R7151:Krt83 UTSW 15 101489648 missense probably damaging 1.00
R7186:Krt83 UTSW 15 101487202 splice site probably null
R7297:Krt83 UTSW 15 101489647 missense probably benign 0.42
R7708:Krt83 UTSW 15 101487932 missense probably benign 0.00
R7796:Krt83 UTSW 15 101485984 missense possibly damaging 0.95
R8172:Krt83 UTSW 15 101485403 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- ATTCTAGAAGCAGCCTCTTGCC -3'
(R):5'- CTGACCACTGTGCATCTTGC -3'

Sequencing Primer
(F):5'- TCAGCCTGAGTGAGCATGATC -3'
(R):5'- ATGAAGGCCACAGTGATC -3'
Posted On2015-07-06