Incidental Mutation 'R4364:Olfr1425'
ID325689
Institutional Source Beutler Lab
Gene Symbol Olfr1425
Ensembl Gene ENSMUSG00000067526
Gene Nameolfactory receptor 1425
SynonymsGA_x6K02T2RE5P-2433425-2432490, MOR239-7
MMRRC Submission 041672-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R4364 (G1)
Quality Score205
Status Validated
Chromosome19
Chromosomal Location12073234-12077731 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12074497 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 45 (V45A)
Ref Sequence ENSEMBL: ENSMUSP00000151154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087828] [ENSMUST00000207681] [ENSMUST00000214918]
Predicted Effect probably benign
Transcript: ENSMUST00000087828
AA Change: V46A

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000085130
Gene: ENSMUSG00000067526
AA Change: V46A

DomainStartEndE-ValueType
Pfam:7tm_4 30 303 9.3e-48 PFAM
Pfam:7tm_1 40 286 8.8e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207681
AA Change: V45A
Predicted Effect probably benign
Transcript: ENSMUST00000214918
AA Change: V45A

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 93% (40/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 T G 4: 59,082,294 T445P possibly damaging Het
Amn A C 12: 111,271,762 N37H probably damaging Het
Apoa5 A T 9: 46,270,529 D301V probably damaging Het
Atrn A G 2: 130,970,208 E691G probably benign Het
Ccer1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 10: 97,694,370 probably benign Het
Cct2 A G 10: 117,055,151 V396A probably damaging Het
Dhx35 C T 2: 158,842,352 Q516* probably null Het
Dopey2 A G 16: 93,770,924 K1413R probably benign Het
Dpp9 T C 17: 56,187,391 H856R possibly damaging Het
Eif4e2 T C 1: 87,224,371 F97L probably benign Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Exoc6b A T 6: 85,003,179 probably benign Het
Fat1 T A 8: 44,952,962 S917T probably benign Het
Frem1 A T 4: 82,913,251 Y2043N probably damaging Het
Galnt14 A G 17: 73,512,159 I312T probably damaging Het
Glipr1 T C 10: 111,985,637 N220S possibly damaging Het
Grid1 A G 14: 34,946,032 E172G probably benign Het
Hspa4l C A 3: 40,766,809 probably null Het
Il1rl2 G T 1: 40,351,791 R298L probably benign Het
Il7r T A 15: 9,512,928 H165L probably damaging Het
Krt83 T G 15: 101,487,514 M326L probably benign Het
Lcn10 G T 2: 25,684,040 C85F probably damaging Het
Nup205 C A 6: 35,192,027 P397Q probably benign Het
Olfr1293-ps G A 2: 111,527,640 V127M probably benign Het
Olfr876 A T 9: 37,804,190 H93L probably benign Het
Prkce C T 17: 86,476,851 T218I probably damaging Het
Rhbdl2 T A 4: 123,809,935 M1K probably null Het
Ripor2 C T 13: 24,721,711 P947S probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sptbn5 A G 2: 120,068,655 L428P probably damaging Het
Syne1 A G 10: 5,353,987 V789A probably damaging Het
Taar8c C T 10: 24,101,579 V112M probably benign Het
Tex10 T C 4: 48,468,774 I51V probably benign Het
Ttll1 T A 15: 83,499,994 Q144L probably damaging Het
Other mutations in Olfr1425
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01936:Olfr1425 APN 19 12074057 missense probably benign 0.00
IGL02508:Olfr1425 APN 19 12073887 missense possibly damaging 0.90
IGL03183:Olfr1425 APN 19 12074028 missense probably damaging 0.98
R1164:Olfr1425 UTSW 19 12074241 nonsense probably null
R1866:Olfr1425 UTSW 19 12073819 missense probably benign 0.03
R3745:Olfr1425 UTSW 19 12074380 missense probably damaging 1.00
R4888:Olfr1425 UTSW 19 12074315 missense probably damaging 1.00
R4962:Olfr1425 UTSW 19 12074275 missense probably damaging 1.00
R5954:Olfr1425 UTSW 19 12074083 missense possibly damaging 0.96
R6383:Olfr1425 UTSW 19 12074363 missense probably damaging 1.00
R6409:Olfr1425 UTSW 19 12074747 start gained probably benign
R6417:Olfr1425 UTSW 19 12073960 missense probably benign 0.18
R6420:Olfr1425 UTSW 19 12073960 missense probably benign 0.18
R7109:Olfr1425 UTSW 19 12074212 missense probably benign
R7446:Olfr1425 UTSW 19 12073697 makesense probably null
R7505:Olfr1425 UTSW 19 12074605 missense possibly damaging 0.88
Z1176:Olfr1425 UTSW 19 12073840 missense probably damaging 1.00
Z1176:Olfr1425 UTSW 19 12073910 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGGCTTAGAGATGGCCAC -3'
(R):5'- TGAGCATCTGAATTGTGCCC -3'

Sequencing Primer
(F):5'- GATGGCCACATATCGATCTAGAGC -3'
(R):5'- GCATCTGAATTGTGCCCTAAGAGC -3'
Posted On2015-07-06