Incidental Mutation 'R4365:Emilin3'
ID 325699
Institutional Source Beutler Lab
Gene Symbol Emilin3
Ensembl Gene ENSMUSG00000050700
Gene Name elastin microfibril interfacer 3
Synonyms Emilin5, EMILIN-T
MMRRC Submission 041113-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4365 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 160906437-160912328 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 160908486 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 401 (R401G)
Ref Sequence ENSEMBL: ENSMUSP00000105080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040872] [ENSMUST00000057169] [ENSMUST00000109454] [ENSMUST00000109455] [ENSMUST00000109456] [ENSMUST00000109457]
AlphaFold P59900
Predicted Effect probably benign
Transcript: ENSMUST00000040872
SMART Domains Protein: ENSMUSP00000043053
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 5.8e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
LNS2 637 793 1.4e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057169
AA Change: R448G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000059732
Gene: ENSMUSG00000050700
AA Change: R448G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:EMI 55 125 7.3e-18 PFAM
low complexity region 144 161 N/A INTRINSIC
low complexity region 281 295 N/A INTRINSIC
low complexity region 359 381 N/A INTRINSIC
low complexity region 451 460 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109454
AA Change: R401G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105080
Gene: ENSMUSG00000050700
AA Change: R401G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:EMI 54 127 6.4e-22 PFAM
low complexity region 144 161 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
low complexity region 312 334 N/A INTRINSIC
low complexity region 404 413 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109455
SMART Domains Protein: ENSMUSP00000105081
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 2.4e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 528 538 N/A INTRINSIC
LNS2 606 762 1.4e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109456
SMART Domains Protein: ENSMUSP00000105082
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 5.8e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
LNS2 637 793 1.4e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109457
SMART Domains Protein: ENSMUSP00000105083
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 110 4.1e-48 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
Pfam:Lipin_mid 435 538 9.5e-35 PFAM
low complexity region 569 579 N/A INTRINSIC
LNS2 647 803 1.4e-105 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124920
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apob A T 12: 8,016,083 I4318F possibly damaging Het
Btrc G A 19: 45,513,480 D213N probably damaging Het
C4b T A 17: 34,734,743 I964F possibly damaging Het
Cacna1f G T X: 7,609,974 A123S probably damaging Het
Ccdc153 G A 9: 44,243,592 A71T probably damaging Het
Celsr3 C A 9: 108,829,847 D1176E possibly damaging Het
Cfap46 A C 7: 139,650,952 V920G probably damaging Het
Cnot10 T A 9: 114,631,881 K74* probably null Het
Dnajb12 T C 10: 59,879,766 F30S probably damaging Het
F5 A G 1: 164,184,950 T478A probably damaging Het
Hspa4l C A 3: 40,766,809 probably null Het
Il1rl2 G T 1: 40,351,791 R298L probably benign Het
Lipo2 A T 19: 33,721,708 S307R probably damaging Het
Lrit2 T A 14: 37,072,119 L380Q probably damaging Het
Ncan A G 8: 70,115,211 S84P probably damaging Het
Ncoa2 T C 1: 13,180,547 I304V probably damaging Het
Nfe2l2 T C 2: 75,679,428 D16G probably damaging Het
Nt5dc1 T C 10: 34,310,381 D397G probably benign Het
Obsl1 A C 1: 75,488,049 L1576R possibly damaging Het
Olfr110 T C 17: 37,499,379 S243P probably damaging Het
Olfr491 A T 7: 108,317,106 I71F probably benign Het
Olfr805 A G 10: 129,723,412 I44T probably damaging Het
Pcdh17 A G 14: 84,448,286 E731G probably damaging Het
Rag1 T A 2: 101,642,943 K618M probably damaging Het
Ripor2 C T 13: 24,721,711 P947S probably benign Het
Rnf150 A G 8: 82,864,115 K36E probably benign Het
S100a9 T C 3: 90,692,774 H105R unknown Het
Spindoc T C 19: 7,373,854 D246G possibly damaging Het
St8sia4 A T 1: 95,591,792 Y324N possibly damaging Het
Tlr11 T A 14: 50,361,469 I304N probably damaging Het
Trpm3 A G 19: 22,978,330 T1090A probably benign Het
Ube4a T C 9: 44,960,081 N7D probably damaging Het
Other mutations in Emilin3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01104:Emilin3 APN 2 160909783 missense probably damaging 1.00
IGL02231:Emilin3 APN 2 160908515 missense probably damaging 1.00
IGL02812:Emilin3 APN 2 160908729 nonsense probably null
IGL02813:Emilin3 APN 2 160908729 nonsense probably null
IGL02892:Emilin3 APN 2 160909149 missense possibly damaging 0.72
IGL03012:Emilin3 APN 2 160908729 nonsense probably null
IGL03017:Emilin3 APN 2 160908729 nonsense probably null
IGL03083:Emilin3 APN 2 160908729 nonsense probably null
IGL03094:Emilin3 APN 2 160908729 nonsense probably null
IGL03163:Emilin3 APN 2 160908729 nonsense probably null
IGL03206:Emilin3 APN 2 160910799 missense probably damaging 1.00
IGL02835:Emilin3 UTSW 2 160908729 nonsense probably null
IGL03046:Emilin3 UTSW 2 160908729 nonsense probably null
PIT1430001:Emilin3 UTSW 2 160908482 missense possibly damaging 0.48
R0373:Emilin3 UTSW 2 160909817 missense probably benign 0.00
R0392:Emilin3 UTSW 2 160910879 unclassified probably benign
R0420:Emilin3 UTSW 2 160910879 unclassified probably benign
R0627:Emilin3 UTSW 2 160908176 missense probably damaging 1.00
R0628:Emilin3 UTSW 2 160910879 unclassified probably benign
R0671:Emilin3 UTSW 2 160908329 missense probably damaging 1.00
R1655:Emilin3 UTSW 2 160910866 critical splice acceptor site probably null
R2016:Emilin3 UTSW 2 160909610 missense possibly damaging 0.85
R2017:Emilin3 UTSW 2 160909610 missense possibly damaging 0.85
R3624:Emilin3 UTSW 2 160908257 missense possibly damaging 0.59
R4062:Emilin3 UTSW 2 160907796 missense probably benign
R4307:Emilin3 UTSW 2 160908317 missense probably damaging 1.00
R4669:Emilin3 UTSW 2 160910797 missense probably benign 0.00
R5076:Emilin3 UTSW 2 160909318 critical splice acceptor site probably null
R5227:Emilin3 UTSW 2 160909265 missense probably damaging 1.00
R5725:Emilin3 UTSW 2 160908490 nonsense probably null
R5914:Emilin3 UTSW 2 160909070 missense probably damaging 1.00
R6030:Emilin3 UTSW 2 160909185 missense probably benign
R6030:Emilin3 UTSW 2 160909185 missense probably benign
R6919:Emilin3 UTSW 2 160908098 missense probably damaging 1.00
R7353:Emilin3 UTSW 2 160908821 missense probably damaging 0.99
R7618:Emilin3 UTSW 2 160909279 missense probably benign 0.04
R7773:Emilin3 UTSW 2 160910798 nonsense probably null
R7785:Emilin3 UTSW 2 160910774 nonsense probably null
R8082:Emilin3 UTSW 2 160908146 missense probably damaging 0.99
R8187:Emilin3 UTSW 2 160908080 missense possibly damaging 0.49
R8887:Emilin3 UTSW 2 160909188 missense possibly damaging 0.52
R9241:Emilin3 UTSW 2 160908257 missense possibly damaging 0.59
RF009:Emilin3 UTSW 2 160909092 missense probably benign 0.00
Z1177:Emilin3 UTSW 2 160907801 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTTCCAGTACTGCTAGTTCTGAATG -3'
(R):5'- TTGCATCAGAGCCTCGATGG -3'

Sequencing Primer
(F):5'- TTCTGAATGAACAAGCGGCC -3'
(R):5'- AACTGGCTTTGATCAGTGCC -3'
Posted On 2015-07-06