Incidental Mutation 'R4365:S100a9'
ID325701
Institutional Source Beutler Lab
Gene Symbol S100a9
Ensembl Gene ENSMUSG00000056071
Gene NameS100 calcium binding protein A9 (calgranulin B)
Synonyms60B8Ag, GAGB, Cagb, p14, MRP14, BEE22, L1Ag
MMRRC Submission 041113-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R4365 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location90692632-90695721 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90692774 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 105 (H105R)
Ref Sequence ENSEMBL: ENSMUSP00000112843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069960] [ENSMUST00000117167]
Predicted Effect unknown
Transcript: ENSMUST00000069960
AA Change: H105R
SMART Domains Protein: ENSMUSP00000070842
Gene: ENSMUSG00000056071
AA Change: H105R

DomainStartEndE-ValueType
Pfam:S_100 9 51 6.7e-23 PFAM
low complexity region 102 113 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000117167
AA Change: H105R
SMART Domains Protein: ENSMUSP00000112843
Gene: ENSMUSG00000056071
AA Change: H105R

DomainStartEndE-ValueType
Pfam:S_100 9 52 5.2e-24 PFAM
low complexity region 102 113 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein may function in the inhibition of casein kinase and altered expression of this protein is associated with the disease cystic fibrosis. This antimicrobial protein exhibits antifungal and antibacterial activity. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for one null allele exhibit abnormal immune physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apob A T 12: 8,016,083 I4318F possibly damaging Het
Btrc G A 19: 45,513,480 D213N probably damaging Het
C4b T A 17: 34,734,743 I964F possibly damaging Het
Cacna1f G T X: 7,609,974 A123S probably damaging Het
Ccdc153 G A 9: 44,243,592 A71T probably damaging Het
Celsr3 C A 9: 108,829,847 D1176E possibly damaging Het
Cfap46 A C 7: 139,650,952 V920G probably damaging Het
Cnot10 T A 9: 114,631,881 K74* probably null Het
Dnajb12 T C 10: 59,879,766 F30S probably damaging Het
Emilin3 T C 2: 160,908,486 R401G probably benign Het
F5 A G 1: 164,184,950 T478A probably damaging Het
Hspa4l C A 3: 40,766,809 probably null Het
Il1rl2 G T 1: 40,351,791 R298L probably benign Het
Lipo2 A T 19: 33,721,708 S307R probably damaging Het
Lrit2 T A 14: 37,072,119 L380Q probably damaging Het
Ncan A G 8: 70,115,211 S84P probably damaging Het
Ncoa2 T C 1: 13,180,547 I304V probably damaging Het
Nfe2l2 T C 2: 75,679,428 D16G probably damaging Het
Nt5dc1 T C 10: 34,310,381 D397G probably benign Het
Obsl1 A C 1: 75,488,049 L1576R possibly damaging Het
Olfr110 T C 17: 37,499,379 S243P probably damaging Het
Olfr491 A T 7: 108,317,106 I71F probably benign Het
Olfr805 A G 10: 129,723,412 I44T probably damaging Het
Pcdh17 A G 14: 84,448,286 E731G probably damaging Het
Rag1 T A 2: 101,642,943 K618M probably damaging Het
Ripor2 C T 13: 24,721,711 P947S probably benign Het
Rnf150 A G 8: 82,864,115 K36E probably benign Het
Spindoc T C 19: 7,373,854 D246G possibly damaging Het
St8sia4 A T 1: 95,591,792 Y324N possibly damaging Het
Tlr11 T A 14: 50,361,469 I304N probably damaging Het
Trpm3 A G 19: 22,978,330 T1090A probably benign Het
Ube4a T C 9: 44,960,081 N7D probably damaging Het
Other mutations in S100a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02136:S100a9 APN 3 90692768 missense probably benign 0.23
IGL02343:S100a9 APN 3 90695224 missense probably damaging 1.00
R0748:S100a9 UTSW 3 90692891 missense possibly damaging 0.73
R5919:S100a9 UTSW 3 90695188 missense probably damaging 1.00
R5953:S100a9 UTSW 3 90692927 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGGAAGGCGTACACTTCAG -3'
(R):5'- TCCTCTATTTCACCCACAGAAAGAG -3'

Sequencing Primer
(F):5'- TTTATCACTCAGAGCCTGGGAAG -3'
(R):5'- TATTTCACCCACAGAAAGAGAAGAG -3'
Posted On2015-07-06