Incidental Mutation 'R4365:Rnf150'
ID325706
Institutional Source Beutler Lab
Gene Symbol Rnf150
Ensembl Gene ENSMUSG00000047747
Gene Namering finger protein 150
SynonymsGreul5, A630007N06Rik, C030044C12Rik
MMRRC Submission 041113-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R4365 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location82863356-83091268 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82864115 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 36 (K36E)
Ref Sequence ENSEMBL: ENSMUSP00000077610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078525]
Predicted Effect probably benign
Transcript: ENSMUST00000078525
AA Change: K36E

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000077610
Gene: ENSMUSG00000047747
AA Change: K36E

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
Pfam:PA 84 180 2.1e-12 PFAM
transmembrane domain 207 229 N/A INTRINSIC
RING 277 317 1.29e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211714
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apob A T 12: 8,016,083 I4318F possibly damaging Het
Btrc G A 19: 45,513,480 D213N probably damaging Het
C4b T A 17: 34,734,743 I964F possibly damaging Het
Cacna1f G T X: 7,609,974 A123S probably damaging Het
Ccdc153 G A 9: 44,243,592 A71T probably damaging Het
Celsr3 C A 9: 108,829,847 D1176E possibly damaging Het
Cfap46 A C 7: 139,650,952 V920G probably damaging Het
Cnot10 T A 9: 114,631,881 K74* probably null Het
Dnajb12 T C 10: 59,879,766 F30S probably damaging Het
Emilin3 T C 2: 160,908,486 R401G probably benign Het
F5 A G 1: 164,184,950 T478A probably damaging Het
Hspa4l C A 3: 40,766,809 probably null Het
Il1rl2 G T 1: 40,351,791 R298L probably benign Het
Lipo2 A T 19: 33,721,708 S307R probably damaging Het
Lrit2 T A 14: 37,072,119 L380Q probably damaging Het
Ncan A G 8: 70,115,211 S84P probably damaging Het
Ncoa2 T C 1: 13,180,547 I304V probably damaging Het
Nfe2l2 T C 2: 75,679,428 D16G probably damaging Het
Nt5dc1 T C 10: 34,310,381 D397G probably benign Het
Obsl1 A C 1: 75,488,049 L1576R possibly damaging Het
Olfr110 T C 17: 37,499,379 S243P probably damaging Het
Olfr491 A T 7: 108,317,106 I71F probably benign Het
Olfr805 A G 10: 129,723,412 I44T probably damaging Het
Pcdh17 A G 14: 84,448,286 E731G probably damaging Het
Rag1 T A 2: 101,642,943 K618M probably damaging Het
Ripor2 C T 13: 24,721,711 P947S probably benign Het
S100a9 T C 3: 90,692,774 H105R unknown Het
Spindoc T C 19: 7,373,854 D246G possibly damaging Het
St8sia4 A T 1: 95,591,792 Y324N possibly damaging Het
Tlr11 T A 14: 50,361,469 I304N probably damaging Het
Trpm3 A G 19: 22,978,330 T1090A probably benign Het
Ube4a T C 9: 44,960,081 N7D probably damaging Het
Other mutations in Rnf150
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02183:Rnf150 APN 8 83003605 missense probably damaging 0.96
R0512:Rnf150 UTSW 8 82864178 missense probably benign 0.01
R1848:Rnf150 UTSW 8 82864010 start codon destroyed possibly damaging 0.67
R2078:Rnf150 UTSW 8 83003605 missense probably damaging 0.96
R2192:Rnf150 UTSW 8 82864391 missense probably damaging 0.98
R3918:Rnf150 UTSW 8 82864461 missense probably benign 0.25
R4781:Rnf150 UTSW 8 82864152 missense probably damaging 1.00
R4810:Rnf150 UTSW 8 82990362 missense possibly damaging 0.66
R4859:Rnf150 UTSW 8 82864083 missense probably damaging 1.00
R5677:Rnf150 UTSW 8 83003599 nonsense probably null
R6022:Rnf150 UTSW 8 83042729 missense probably benign 0.00
R6241:Rnf150 UTSW 8 82864464 missense possibly damaging 0.82
R6283:Rnf150 UTSW 8 82990554 missense probably damaging 1.00
R6306:Rnf150 UTSW 8 83083502 missense possibly damaging 0.90
R7014:Rnf150 UTSW 8 83042663 missense probably benign
R7023:Rnf150 UTSW 8 82864077 missense probably damaging 0.97
R7394:Rnf150 UTSW 8 82990471 nonsense probably null
R7710:Rnf150 UTSW 8 82864152 missense probably damaging 1.00
R7771:Rnf150 UTSW 8 82864203 missense probably benign 0.00
R8073:Rnf150 UTSW 8 82863917
Predicted Primers PCR Primer
(F):5'- ATAGTCCCAGCACCGAGGAT -3'
(R):5'- TGAGGGCTATCCAGTGCTTG -3'

Sequencing Primer
(F):5'- GCCACCTCTATGAGAGAAGGCG -3'
(R):5'- ATCCAGTGCTTGCCGTG -3'
Posted On2015-07-06