Incidental Mutation 'R4365:Nt5dc1'
ID325711
Institutional Source Beutler Lab
Gene Symbol Nt5dc1
Ensembl Gene ENSMUSG00000039480
Gene Name5'-nucleotidase domain containing 1
SynonymsNt5c2l1, 6030401B09Rik
MMRRC Submission 041113-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4365 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location34288288-34418552 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34310381 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 397 (D397G)
Ref Sequence ENSEMBL: ENSMUSP00000101151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047885] [ENSMUST00000105512]
Predicted Effect probably benign
Transcript: ENSMUST00000047885
AA Change: D398G

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000047126
Gene: ENSMUSG00000039480
AA Change: D398G

DomainStartEndE-ValueType
Pfam:5_nucleotid 1 382 2.6e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105512
AA Change: D397G

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101151
Gene: ENSMUSG00000039480
AA Change: D397G

DomainStartEndE-ValueType
Pfam:5_nucleotid 1 372 8.7e-54 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000129363
AA Change: D61G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130290
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] While the exact function of the protein encoded by this gene is not known, it belongs to the 5'(3')-deoxyribonucleotidase family. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apob A T 12: 8,016,083 I4318F possibly damaging Het
Btrc G A 19: 45,513,480 D213N probably damaging Het
C4b T A 17: 34,734,743 I964F possibly damaging Het
Cacna1f G T X: 7,609,974 A123S probably damaging Het
Ccdc153 G A 9: 44,243,592 A71T probably damaging Het
Celsr3 C A 9: 108,829,847 D1176E possibly damaging Het
Cfap46 A C 7: 139,650,952 V920G probably damaging Het
Cnot10 T A 9: 114,631,881 K74* probably null Het
Dnajb12 T C 10: 59,879,766 F30S probably damaging Het
Emilin3 T C 2: 160,908,486 R401G probably benign Het
F5 A G 1: 164,184,950 T478A probably damaging Het
Hspa4l C A 3: 40,766,809 probably null Het
Il1rl2 G T 1: 40,351,791 R298L probably benign Het
Lipo2 A T 19: 33,721,708 S307R probably damaging Het
Lrit2 T A 14: 37,072,119 L380Q probably damaging Het
Ncan A G 8: 70,115,211 S84P probably damaging Het
Ncoa2 T C 1: 13,180,547 I304V probably damaging Het
Nfe2l2 T C 2: 75,679,428 D16G probably damaging Het
Obsl1 A C 1: 75,488,049 L1576R possibly damaging Het
Olfr110 T C 17: 37,499,379 S243P probably damaging Het
Olfr491 A T 7: 108,317,106 I71F probably benign Het
Olfr805 A G 10: 129,723,412 I44T probably damaging Het
Pcdh17 A G 14: 84,448,286 E731G probably damaging Het
Rag1 T A 2: 101,642,943 K618M probably damaging Het
Ripor2 C T 13: 24,721,711 P947S probably benign Het
Rnf150 A G 8: 82,864,115 K36E probably benign Het
S100a9 T C 3: 90,692,774 H105R unknown Het
Spindoc T C 19: 7,373,854 D246G possibly damaging Het
St8sia4 A T 1: 95,591,792 Y324N possibly damaging Het
Tlr11 T A 14: 50,361,469 I304N probably damaging Het
Trpm3 A G 19: 22,978,330 T1090A probably benign Het
Ube4a T C 9: 44,960,081 N7D probably damaging Het
Other mutations in Nt5dc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Nt5dc1 APN 10 34407557 missense possibly damaging 0.80
IGL02096:Nt5dc1 APN 10 34399810 nonsense probably null
IGL02471:Nt5dc1 APN 10 34403725 missense probably benign 0.03
IGL03345:Nt5dc1 APN 10 34324462 missense probably benign 0.04
R0083:Nt5dc1 UTSW 10 34403764 missense probably damaging 0.98
R1159:Nt5dc1 UTSW 10 34398173 missense possibly damaging 0.93
R1898:Nt5dc1 UTSW 10 34313635 missense probably benign 0.00
R1901:Nt5dc1 UTSW 10 34313671 missense probably damaging 1.00
R2327:Nt5dc1 UTSW 10 34313677 missense possibly damaging 0.66
R4942:Nt5dc1 UTSW 10 34322677 missense probably damaging 1.00
R4943:Nt5dc1 UTSW 10 34310391 missense probably damaging 1.00
R5168:Nt5dc1 UTSW 10 34397240 missense probably benign 0.05
R5507:Nt5dc1 UTSW 10 34397230 missense probably benign
R5605:Nt5dc1 UTSW 10 34403695 missense probably benign 0.12
R6406:Nt5dc1 UTSW 10 34324408 missense probably benign 0.04
R6495:Nt5dc1 UTSW 10 34324369 missense probably damaging 1.00
R6799:Nt5dc1 UTSW 10 34313707 missense possibly damaging 0.79
R6835:Nt5dc1 UTSW 10 34310379 missense probably benign 0.04
R7480:Nt5dc1 UTSW 10 34324453 missense probably damaging 1.00
R7480:Nt5dc1 UTSW 10 34324454 missense probably damaging 1.00
R7486:Nt5dc1 UTSW 10 34399809 missense probably benign 0.26
R7493:Nt5dc1 UTSW 10 34304936 missense probably benign 0.00
R7638:Nt5dc1 UTSW 10 34314796 missense probably benign 0.04
R8042:Nt5dc1 UTSW 10 34397214 missense probably benign 0.19
R8160:Nt5dc1 UTSW 10 34324396 missense possibly damaging 0.79
R8268:Nt5dc1 UTSW 10 34310411 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGAAGACCGCTCCTTTTGAAG -3'
(R):5'- GTTAAAGTGCACTCATAGTAAGGAG -3'

Sequencing Primer
(F):5'- TGAAGACAACAGCTCTCTCTAATGG -3'
(R):5'- GCCCTTAGGTCCCTGTAGC -3'
Posted On2015-07-06