Incidental Mutation 'R4365:Lrit2'
ID325716
Institutional Source Beutler Lab
Gene Symbol Lrit2
Ensembl Gene ENSMUSG00000043418
Gene Nameleucine-rich repeat, immunoglobulin-like and transmembrane domains 2
SynonymsA930010E21Rik, Lrrc22
MMRRC Submission 041113-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R4365 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location37067929-37073743 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37072119 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 380 (L380Q)
Ref Sequence ENSEMBL: ENSMUSP00000056642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057176]
Predicted Effect probably damaging
Transcript: ENSMUST00000057176
AA Change: L380Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056642
Gene: ENSMUSG00000043418
AA Change: L380Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 23 59 7.74e-2 SMART
LRR 78 101 9.96e-1 SMART
LRR_TYP 102 125 8.94e-3 SMART
LRR 126 149 2.03e1 SMART
LRR_TYP 150 173 7.67e-2 SMART
LRRCT 200 251 7.12e-7 SMART
IGc2 265 334 2.05e-9 SMART
FN3 362 443 5.94e0 SMART
transmembrane domain 463 485 N/A INTRINSIC
low complexity region 538 546 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224104
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apob A T 12: 8,016,083 I4318F possibly damaging Het
Btrc G A 19: 45,513,480 D213N probably damaging Het
C4b T A 17: 34,734,743 I964F possibly damaging Het
Cacna1f G T X: 7,609,974 A123S probably damaging Het
Ccdc153 G A 9: 44,243,592 A71T probably damaging Het
Celsr3 C A 9: 108,829,847 D1176E possibly damaging Het
Cfap46 A C 7: 139,650,952 V920G probably damaging Het
Cnot10 T A 9: 114,631,881 K74* probably null Het
Dnajb12 T C 10: 59,879,766 F30S probably damaging Het
Emilin3 T C 2: 160,908,486 R401G probably benign Het
F5 A G 1: 164,184,950 T478A probably damaging Het
Hspa4l C A 3: 40,766,809 probably null Het
Il1rl2 G T 1: 40,351,791 R298L probably benign Het
Lipo2 A T 19: 33,721,708 S307R probably damaging Het
Ncan A G 8: 70,115,211 S84P probably damaging Het
Ncoa2 T C 1: 13,180,547 I304V probably damaging Het
Nfe2l2 T C 2: 75,679,428 D16G probably damaging Het
Nt5dc1 T C 10: 34,310,381 D397G probably benign Het
Obsl1 A C 1: 75,488,049 L1576R possibly damaging Het
Olfr110 T C 17: 37,499,379 S243P probably damaging Het
Olfr491 A T 7: 108,317,106 I71F probably benign Het
Olfr805 A G 10: 129,723,412 I44T probably damaging Het
Pcdh17 A G 14: 84,448,286 E731G probably damaging Het
Rag1 T A 2: 101,642,943 K618M probably damaging Het
Ripor2 C T 13: 24,721,711 P947S probably benign Het
Rnf150 A G 8: 82,864,115 K36E probably benign Het
S100a9 T C 3: 90,692,774 H105R unknown Het
Spindoc T C 19: 7,373,854 D246G possibly damaging Het
St8sia4 A T 1: 95,591,792 Y324N possibly damaging Het
Tlr11 T A 14: 50,361,469 I304N probably damaging Het
Trpm3 A G 19: 22,978,330 T1090A probably benign Het
Ube4a T C 9: 44,960,081 N7D probably damaging Het
Other mutations in Lrit2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Lrit2 APN 14 37071963 missense probably benign 0.31
IGL01475:Lrit2 APN 14 37069094 missense probably damaging 1.00
IGL02080:Lrit2 APN 14 37069074 missense probably damaging 0.99
IGL02141:Lrit2 APN 14 37068074 unclassified probably benign
IGL02479:Lrit2 APN 14 37072278 missense probably damaging 0.99
IGL02715:Lrit2 APN 14 37072548 missense probably benign 0.00
R0114:Lrit2 UTSW 14 37068045 unclassified probably null
R1344:Lrit2 UTSW 14 37068556 missense probably benign 0.32
R1529:Lrit2 UTSW 14 37068827 missense probably benign 0.12
R1641:Lrit2 UTSW 14 37069148 missense probably benign 0.34
R2105:Lrit2 UTSW 14 37071956 missense probably damaging 1.00
R4645:Lrit2 UTSW 14 37072475 missense probably benign
R5226:Lrit2 UTSW 14 37072353 missense probably damaging 1.00
R5377:Lrit2 UTSW 14 37069183 missense possibly damaging 0.59
R5387:Lrit2 UTSW 14 37072259 missense probably damaging 1.00
R5840:Lrit2 UTSW 14 37069005 missense possibly damaging 0.64
R5881:Lrit2 UTSW 14 37072235 missense probably benign 0.02
R6499:Lrit2 UTSW 14 37068810 missense probably damaging 0.98
R6863:Lrit2 UTSW 14 37071944 missense probably damaging 0.99
R7307:Lrit2 UTSW 14 37072199 missense probably benign 0.00
R7316:Lrit2 UTSW 14 37068858 missense probably damaging 1.00
R7491:Lrit2 UTSW 14 37068910 missense possibly damaging 0.83
R7525:Lrit2 UTSW 14 37072493 missense possibly damaging 0.76
R7640:Lrit2 UTSW 14 37072124 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCAACTGGTAGATGGCG -3'
(R):5'- CTACAGTGACATGCAAGAGGTG -3'

Sequencing Primer
(F):5'- ACTGGTAGATGGCGGTAATTATACC -3'
(R):5'- AGAGGTGCTCACGACCCTCTAG -3'
Posted On2015-07-06