Incidental Mutation 'R4365:Tlr11'
ID 325717
Institutional Source Beutler Lab
Gene Symbol Tlr11
Ensembl Gene ENSMUSG00000051969
Gene Name toll-like receptor 11
Synonyms LOC239081
MMRRC Submission 041113-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4365 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 50357914-50363663 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 50361469 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 304 (I304N)
Ref Sequence ENSEMBL: ENSMUSP00000138814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063570] [ENSMUST00000185091]
AlphaFold Q6R5P0
Predicted Effect probably damaging
Transcript: ENSMUST00000063570
AA Change: I299N

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000068906
Gene: ENSMUSG00000051969
AA Change: I299N

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 105 122 N/A INTRINSIC
low complexity region 153 161 N/A INTRINSIC
LRR 311 333 3.36e1 SMART
LRR 335 361 4.44e0 SMART
LRR 362 383 2.03e1 SMART
LRR_TYP 384 407 2.57e-3 SMART
LRR_TYP 408 431 2.75e-3 SMART
low complexity region 544 556 N/A INTRINSIC
LRR 605 628 6.06e1 SMART
transmembrane domain 719 741 N/A INTRINSIC
Pfam:TIR 773 922 2.1e-9 PFAM
Pfam:TIR_2 776 894 6.6e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000185091
AA Change: I304N

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138814
Gene: ENSMUSG00000051969
AA Change: I304N

DomainStartEndE-ValueType
transmembrane domain 16 38 N/A INTRINSIC
low complexity region 110 127 N/A INTRINSIC
low complexity region 158 166 N/A INTRINSIC
Pfam:LRR_6 221 244 5.3e-2 PFAM
LRR 316 338 3.36e1 SMART
LRR 340 366 4.44e0 SMART
LRR 367 388 2.03e1 SMART
LRR_TYP 389 412 2.57e-3 SMART
LRR_TYP 413 436 2.75e-3 SMART
low complexity region 549 561 N/A INTRINSIC
LRR 610 633 6.06e1 SMART
transmembrane domain 724 746 N/A INTRINSIC
Pfam:TIR_2 781 898 1e-12 PFAM
Pfam:TIR 781 922 1.8e-13 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apob A T 12: 8,016,083 I4318F possibly damaging Het
Btrc G A 19: 45,513,480 D213N probably damaging Het
C4b T A 17: 34,734,743 I964F possibly damaging Het
Cacna1f G T X: 7,609,974 A123S probably damaging Het
Ccdc153 G A 9: 44,243,592 A71T probably damaging Het
Celsr3 C A 9: 108,829,847 D1176E possibly damaging Het
Cfap46 A C 7: 139,650,952 V920G probably damaging Het
Cnot10 T A 9: 114,631,881 K74* probably null Het
Dnajb12 T C 10: 59,879,766 F30S probably damaging Het
Emilin3 T C 2: 160,908,486 R401G probably benign Het
F5 A G 1: 164,184,950 T478A probably damaging Het
Hspa4l C A 3: 40,766,809 probably null Het
Il1rl2 G T 1: 40,351,791 R298L probably benign Het
Lipo2 A T 19: 33,721,708 S307R probably damaging Het
Lrit2 T A 14: 37,072,119 L380Q probably damaging Het
Ncan A G 8: 70,115,211 S84P probably damaging Het
Ncoa2 T C 1: 13,180,547 I304V probably damaging Het
Nfe2l2 T C 2: 75,679,428 D16G probably damaging Het
Nt5dc1 T C 10: 34,310,381 D397G probably benign Het
Obsl1 A C 1: 75,488,049 L1576R possibly damaging Het
Olfr110 T C 17: 37,499,379 S243P probably damaging Het
Olfr491 A T 7: 108,317,106 I71F probably benign Het
Olfr805 A G 10: 129,723,412 I44T probably damaging Het
Pcdh17 A G 14: 84,448,286 E731G probably damaging Het
Rag1 T A 2: 101,642,943 K618M probably damaging Het
Ripor2 C T 13: 24,721,711 P947S probably benign Het
Rnf150 A G 8: 82,864,115 K36E probably benign Het
S100a9 T C 3: 90,692,774 H105R unknown Het
Spindoc T C 19: 7,373,854 D246G possibly damaging Het
St8sia4 A T 1: 95,591,792 Y324N possibly damaging Het
Trpm3 A G 19: 22,978,330 T1090A probably benign Het
Ube4a T C 9: 44,960,081 N7D probably damaging Het
Other mutations in Tlr11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Tlr11 APN 14 50360916 missense probably benign
IGL02090:Tlr11 APN 14 50363032 missense probably damaging 0.99
IGL02286:Tlr11 APN 14 50360871 missense possibly damaging 0.91
IGL02671:Tlr11 APN 14 50360692 missense probably damaging 1.00
IGL03064:Tlr11 APN 14 50361100 missense probably damaging 1.00
IGL03068:Tlr11 APN 14 50361484 missense probably benign
R0099:Tlr11 UTSW 14 50360818 missense probably benign 0.14
R0727:Tlr11 UTSW 14 50361469 missense possibly damaging 0.67
R0944:Tlr11 UTSW 14 50362336 missense probably benign 0.12
R1490:Tlr11 UTSW 14 50363176 missense probably benign 0.00
R1726:Tlr11 UTSW 14 50361541 missense probably benign 0.00
R1803:Tlr11 UTSW 14 50360647 missense probably benign 0.00
R1908:Tlr11 UTSW 14 50361207 missense probably benign 0.00
R1971:Tlr11 UTSW 14 50361234 missense probably benign
R1981:Tlr11 UTSW 14 50361988 missense possibly damaging 0.95
R2023:Tlr11 UTSW 14 50362569 missense probably damaging 0.96
R2079:Tlr11 UTSW 14 50360980 missense probably damaging 0.99
R2155:Tlr11 UTSW 14 50360682 missense probably benign 0.01
R2251:Tlr11 UTSW 14 50360792 missense probably benign 0.02
R3017:Tlr11 UTSW 14 50362721 nonsense probably null
R3760:Tlr11 UTSW 14 50362243 missense probably damaging 1.00
R3876:Tlr11 UTSW 14 50363154 missense probably benign
R3936:Tlr11 UTSW 14 50362735 missense possibly damaging 0.78
R4002:Tlr11 UTSW 14 50362527 missense probably benign
R4024:Tlr11 UTSW 14 50362846 missense probably benign 0.02
R4118:Tlr11 UTSW 14 50363227 missense probably damaging 1.00
R4222:Tlr11 UTSW 14 50361849 missense probably damaging 0.99
R4678:Tlr11 UTSW 14 50360982 missense possibly damaging 0.85
R4779:Tlr11 UTSW 14 50361250 missense possibly damaging 0.76
R4910:Tlr11 UTSW 14 50362889 missense probably benign 0.45
R4921:Tlr11 UTSW 14 50362885 missense possibly damaging 0.48
R5114:Tlr11 UTSW 14 50363121 missense possibly damaging 0.81
R5126:Tlr11 UTSW 14 50360830 missense probably damaging 1.00
R5349:Tlr11 UTSW 14 50360880 missense probably benign 0.45
R5606:Tlr11 UTSW 14 50362260 missense probably benign 0.08
R5650:Tlr11 UTSW 14 50361201 missense probably benign 0.03
R5958:Tlr11 UTSW 14 50360777 missense probably damaging 0.99
R5966:Tlr11 UTSW 14 50362255 missense probably benign 0.02
R6480:Tlr11 UTSW 14 50363055 missense possibly damaging 0.62
R6484:Tlr11 UTSW 14 50362678 missense probably damaging 0.99
R6679:Tlr11 UTSW 14 50362854 missense probably benign 0.00
R6717:Tlr11 UTSW 14 50362104 missense probably benign
R7085:Tlr11 UTSW 14 50362656 missense probably damaging 0.99
R7241:Tlr11 UTSW 14 50362141 missense possibly damaging 0.95
R7440:Tlr11 UTSW 14 50361344 missense probably benign 0.00
R7482:Tlr11 UTSW 14 50362999 missense probably damaging 0.99
R7582:Tlr11 UTSW 14 50361729 nonsense probably null
R7790:Tlr11 UTSW 14 50361925 missense probably benign
R7818:Tlr11 UTSW 14 50361828 missense probably damaging 1.00
R7827:Tlr11 UTSW 14 50361154 missense probably benign 0.00
R8144:Tlr11 UTSW 14 50362488 missense probably damaging 0.99
R8847:Tlr11 UTSW 14 50362725 missense possibly damaging 0.85
R9027:Tlr11 UTSW 14 50361292 missense probably damaging 1.00
R9035:Tlr11 UTSW 14 50360977 missense probably benign 0.00
R9393:Tlr11 UTSW 14 50362090 missense probably benign 0.03
RF002:Tlr11 UTSW 14 50361225 missense possibly damaging 0.63
Z1088:Tlr11 UTSW 14 50362338 missense possibly damaging 0.48
Z1176:Tlr11 UTSW 14 50360662 missense probably damaging 1.00
Z1176:Tlr11 UTSW 14 50362336 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- ACCTTCAGCTGAAACAGGCAG -3'
(R):5'- CTAAAGAGTCCTTCTGGAAGCTC -3'

Sequencing Primer
(F):5'- GTCAGAGACTTGTATGGCCTCAC -3'
(R):5'- CCAAGATTGGGCCAAGCTTATTC -3'
Posted On 2015-07-06