Mutagenetix > Incidental Mutation

Incidental Mutation 'R4365:Trpm3'

325724

Institutional Source

Beutler Lab

Gene Symbol

Trpm3

Ensembl Gene

ENSMUSG00000052387

Gene Name

transient receptor potential cation channel, subfamily M, member 3

Synonyms

6330504P12Rik, LTRPC3, melastatin 2, B930001P07Rik, MLSN2

MMRRC Submission

041113-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.082) question?

Stock #

R4365 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

22116410-22972774 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 22955694 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1090 (T1090A)

Ref Sequence

ENSEMBL: ENSMUSP00000097164 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037901] [ENSMUST00000074770] [ENSMUST00000087576] [ENSMUST00000099569]

AlphaFold

J9S314

Predicted Effect

probably benign
Transcript: ENSMUST00000037901
AA Change: T1088A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000042184
Gene: ENSMUSG00000052387
AA Change: T1088A

Domain	Start	End	E-Value	Type
Blast:ANK	485	514	1e-6	BLAST
low complexity region	619	631	N/A	INTRINSIC
low complexity region	674	689	N/A	INTRINSIC
low complexity region	788	800	N/A	INTRINSIC
low complexity region	821	840	N/A	INTRINSIC
Pfam:Ion_trans	883	1136	1.7e-19	PFAM
Pfam:TRPM_tetra	1227	1282	1.5e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000074770
AA Change: T1080A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000074328
Gene: ENSMUSG00000052387
AA Change: T1080A

Domain	Start	End	E-Value	Type
low complexity region	16	33	N/A	INTRINSIC
Blast:ANK	487	516	5e-7	BLAST
low complexity region	611	623	N/A	INTRINSIC
low complexity region	666	681	N/A	INTRINSIC
low complexity region	780	792	N/A	INTRINSIC
low complexity region	813	832	N/A	INTRINSIC
transmembrane domain	874	896	N/A	INTRINSIC
Pfam:Ion_trans	908	1116	5.1e-14	PFAM
low complexity region	1378	1388	N/A	INTRINSIC
low complexity region	1433	1455	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000087576
AA Change: T1090A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000084857
Gene: ENSMUSG00000052387
AA Change: T1090A

Domain	Start	End	E-Value	Type
low complexity region	16	33	N/A	INTRINSIC
Blast:ANK	487	516	5e-7	BLAST
low complexity region	621	633	N/A	INTRINSIC
low complexity region	676	691	N/A	INTRINSIC
low complexity region	790	802	N/A	INTRINSIC
low complexity region	823	842	N/A	INTRINSIC
transmembrane domain	884	906	N/A	INTRINSIC
Pfam:Ion_trans	918	1126	5.1e-14	PFAM
low complexity region	1388	1398	N/A	INTRINSIC
low complexity region	1443	1465	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000099569
AA Change: T1090A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000097164
Gene: ENSMUSG00000052387
AA Change: T1090A

Domain	Start	End	E-Value	Type
low complexity region	16	33	N/A	INTRINSIC
Blast:ANK	487	516	6e-7	BLAST
low complexity region	609	621	N/A	INTRINSIC
low complexity region	664	679	N/A	INTRINSIC
low complexity region	778	790	N/A	INTRINSIC
low complexity region	811	830	N/A	INTRINSIC
Pfam:Ion_trans	873	1138	3.2e-19	PFAM
Pfam:TRPM_tetra	1229	1284	4.4e-26	PFAM
low complexity region	1388	1398	N/A	INTRINSIC
low complexity region	1443	1465	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.0%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of transient receptor potential (TRP) channels. TRP channels are cation-selective channels important for cellular calcium signaling and homeostasis. The protein encoded by this gene mediates calcium entry, and this entry is potentiated by calcium store depletion. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display impaired thermal and chemical nociception. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apob	A	T	12: 8,066,083 (GRCm39)	I4318F	possibly damaging	Het
Btrc	G	A	19: 45,501,919 (GRCm39)	D213N	probably damaging	Het
C4b	T	A	17: 34,953,717 (GRCm39)	I964F	possibly damaging	Het
Cacna1f	G	T	X: 7,476,213 (GRCm39)	A123S	probably damaging	Het
Ccdc153	G	A	9: 44,154,889 (GRCm39)	A71T	probably damaging	Het
Celsr3	C	A	9: 108,707,046 (GRCm39)	D1176E	possibly damaging	Het
Cfap46	A	C	7: 139,230,868 (GRCm39)	V920G	probably damaging	Het
Cnot10	T	A	9: 114,460,949 (GRCm39)	K74*	probably null	Het
Dnajb12	T	C	10: 59,715,588 (GRCm39)	F30S	probably damaging	Het
Emilin3	T	C	2: 160,750,406 (GRCm39)	R401G	probably benign	Het
F5	A	G	1: 164,012,519 (GRCm39)	T478A	probably damaging	Het
Hspa4l	C	A	3: 40,721,241 (GRCm39)		probably null	Het
Il1rl2	G	T	1: 40,390,951 (GRCm39)	R298L	probably benign	Het
Lipo2	A	T	19: 33,699,108 (GRCm39)	S307R	probably damaging	Het
Lrit2	T	A	14: 36,794,076 (GRCm39)	L380Q	probably damaging	Het
Ncan	A	G	8: 70,567,861 (GRCm39)	S84P	probably damaging	Het
Ncoa2	T	C	1: 13,250,771 (GRCm39)	I304V	probably damaging	Het
Nfe2l2	T	C	2: 75,509,772 (GRCm39)	D16G	probably damaging	Het
Nt5dc1	T	C	10: 34,186,377 (GRCm39)	D397G	probably benign	Het
Obsl1	A	C	1: 75,464,693 (GRCm39)	L1576R	possibly damaging	Het
Or5p1	A	T	7: 107,916,313 (GRCm39)	I71F	probably benign	Het
Or5v1	T	C	17: 37,810,270 (GRCm39)	S243P	probably damaging	Het
Or6c212	A	G	10: 129,559,281 (GRCm39)	I44T	probably damaging	Het
Pcdh17	A	G	14: 84,685,726 (GRCm39)	E731G	probably damaging	Het
Rag1	T	A	2: 101,473,288 (GRCm39)	K618M	probably damaging	Het
Ripor2	C	T	13: 24,905,694 (GRCm39)	P947S	probably benign	Het
Rnf150	A	G	8: 83,590,744 (GRCm39)	K36E	probably benign	Het
S100a9	T	C	3: 90,600,081 (GRCm39)	H105R	unknown	Het
Spindoc	T	C	19: 7,351,219 (GRCm39)	D246G	possibly damaging	Het
St8sia4	A	T	1: 95,519,517 (GRCm39)	Y324N	possibly damaging	Het
Tlr11	T	A	14: 50,598,926 (GRCm39)	I304N	probably damaging	Het
Ube4a	T	C	9: 44,871,379 (GRCm39)	N7D	probably damaging	Het

Other mutations in Trpm3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00514:Trpm3	APN	19	22,965,023 (GRCm39)	missense	probably benign	0.00
IGL00773:Trpm3	APN	19	22,877,523 (GRCm39)	missense	possibly damaging	0.92
IGL00852:Trpm3	APN	19	22,964,435 (GRCm39)	missense	possibly damaging	0.93
IGL01597:Trpm3	APN	19	22,692,610 (GRCm39)	missense	probably damaging	1.00
IGL01607:Trpm3	APN	19	22,964,491 (GRCm39)	missense	probably benign	0.01
IGL01818:Trpm3	APN	19	22,891,838 (GRCm39)	missense	probably damaging	1.00
IGL01890:Trpm3	APN	19	22,689,083 (GRCm39)	missense	probably damaging	0.98
IGL02016:Trpm3	APN	19	22,879,433 (GRCm39)	nonsense	probably null
IGL02324:Trpm3	APN	19	22,676,143 (GRCm39)	missense	probably benign	0.25
IGL02947:Trpm3	APN	19	22,878,483 (GRCm39)	missense	probably damaging	0.99
IGL03037:Trpm3	APN	19	22,866,776 (GRCm39)	missense	possibly damaging	0.85
IGL03128:Trpm3	APN	19	22,891,829 (GRCm39)	missense	probably damaging	1.00
IGL03335:Trpm3	APN	19	22,903,435 (GRCm39)	critical splice donor site	probably null
IGL03354:Trpm3	APN	19	22,834,082 (GRCm39)	missense	probably damaging	1.00
bit	UTSW	19	22,965,233 (GRCm39)	missense	probably benign	0.00
G1patch:Trpm3	UTSW	19	22,903,392 (GRCm39)	missense	probably damaging	1.00
P0041:Trpm3	UTSW	19	22,875,050 (GRCm39)	missense	probably benign	0.01
R0001:Trpm3	UTSW	19	22,692,695 (GRCm39)	missense	possibly damaging	0.70
R0007:Trpm3	UTSW	19	22,964,893 (GRCm39)	missense	probably benign	0.00
R0007:Trpm3	UTSW	19	22,964,893 (GRCm39)	missense	probably benign	0.00
R0009:Trpm3	UTSW	19	22,891,810 (GRCm39)	missense	probably damaging	1.00
R0009:Trpm3	UTSW	19	22,891,810 (GRCm39)	missense	probably damaging	1.00
R0142:Trpm3	UTSW	19	22,965,280 (GRCm39)	missense	probably damaging	0.98
R0194:Trpm3	UTSW	19	22,692,720 (GRCm39)	splice site	probably null
R0268:Trpm3	UTSW	19	22,874,885 (GRCm39)	critical splice donor site	probably null
R0299:Trpm3	UTSW	19	22,964,237 (GRCm39)	missense	possibly damaging	0.62
R0449:Trpm3	UTSW	19	22,965,418 (GRCm39)	missense	probably benign
R0481:Trpm3	UTSW	19	22,878,435 (GRCm39)	missense	possibly damaging	0.51
R0496:Trpm3	UTSW	19	22,676,142 (GRCm39)	missense	probably benign	0.00
R0499:Trpm3	UTSW	19	22,964,237 (GRCm39)	missense	possibly damaging	0.62
R0550:Trpm3	UTSW	19	22,965,176 (GRCm39)	missense	probably damaging	0.97
R0729:Trpm3	UTSW	19	22,965,153 (GRCm39)	missense	probably benign
R0883:Trpm3	UTSW	19	22,956,018 (GRCm39)	missense	probably damaging	1.00
R0926:Trpm3	UTSW	19	22,965,407 (GRCm39)	missense	probably benign	0.02
R1185:Trpm3	UTSW	19	22,891,781 (GRCm39)	splice site	probably benign
R1185:Trpm3	UTSW	19	22,891,781 (GRCm39)	splice site	probably benign
R1513:Trpm3	UTSW	19	22,964,236 (GRCm39)	missense	possibly damaging	0.96
R1521:Trpm3	UTSW	19	22,878,585 (GRCm39)	missense	probably damaging	1.00
R1522:Trpm3	UTSW	19	22,955,698 (GRCm39)	missense	probably benign	0.39
R1569:Trpm3	UTSW	19	22,866,809 (GRCm39)	critical splice donor site	probably null
R1598:Trpm3	UTSW	19	22,710,388 (GRCm39)	missense	possibly damaging	0.47
R1600:Trpm3	UTSW	19	22,116,519 (GRCm39)	missense	probably benign	0.00
R1616:Trpm3	UTSW	19	22,960,076 (GRCm39)	missense	probably damaging	1.00
R1619:Trpm3	UTSW	19	22,689,271 (GRCm39)	missense	probably damaging	0.99
R1923:Trpm3	UTSW	19	22,862,776 (GRCm39)	missense	probably damaging	1.00
R1985:Trpm3	UTSW	19	22,903,446 (GRCm39)	missense	possibly damaging	0.56
R2002:Trpm3	UTSW	19	22,959,947 (GRCm39)	missense	probably damaging	1.00
R2249:Trpm3	UTSW	19	22,710,398 (GRCm39)	missense	probably benign	0.15
R3719:Trpm3	UTSW	19	22,964,354 (GRCm39)	missense	possibly damaging	0.95
R3766:Trpm3	UTSW	19	22,425,741 (GRCm39)	missense	probably benign
R3774:Trpm3	UTSW	19	22,965,339 (GRCm39)	missense	probably benign	0.03
R3774:Trpm3	UTSW	19	22,955,966 (GRCm39)	missense	possibly damaging	0.66
R3776:Trpm3	UTSW	19	22,955,966 (GRCm39)	missense	possibly damaging	0.66
R3820:Trpm3	UTSW	19	22,964,813 (GRCm39)	missense	probably benign	0.00
R3899:Trpm3	UTSW	19	22,878,524 (GRCm39)	missense	possibly damaging	0.90
R4204:Trpm3	UTSW	19	22,964,928 (GRCm39)	missense	probably benign	0.00
R4238:Trpm3	UTSW	19	22,956,002 (GRCm39)	missense	probably damaging	1.00
R4301:Trpm3	UTSW	19	22,964,656 (GRCm39)	missense	probably benign	0.23
R4344:Trpm3	UTSW	19	22,875,061 (GRCm39)	missense	probably damaging	0.99
R4345:Trpm3	UTSW	19	22,875,061 (GRCm39)	missense	probably damaging	0.99
R4510:Trpm3	UTSW	19	22,965,381 (GRCm39)	missense	probably benign	0.00
R4511:Trpm3	UTSW	19	22,965,381 (GRCm39)	missense	probably benign	0.00
R4565:Trpm3	UTSW	19	22,965,233 (GRCm39)	missense	probably benign	0.00
R4573:Trpm3	UTSW	19	22,879,506 (GRCm39)	missense	probably damaging	1.00
R4606:Trpm3	UTSW	19	22,955,988 (GRCm39)	missense	probably benign	0.26
R4677:Trpm3	UTSW	19	22,964,752 (GRCm39)	missense	possibly damaging	0.95
R4684:Trpm3	UTSW	19	22,965,145 (GRCm39)	missense	probably benign
R4713:Trpm3	UTSW	19	22,866,799 (GRCm39)	missense	possibly damaging	0.83
R4745:Trpm3	UTSW	19	22,692,659 (GRCm39)	missense	possibly damaging	0.67
R5015:Trpm3	UTSW	19	22,689,076 (GRCm39)	missense	probably damaging	1.00
R5030:Trpm3	UTSW	19	22,676,130 (GRCm39)	missense	probably benign	0.01
R5074:Trpm3	UTSW	19	22,862,713 (GRCm39)	missense	possibly damaging	0.65
R5089:Trpm3	UTSW	19	22,744,120 (GRCm39)	missense	probably damaging	0.97
R5100:Trpm3	UTSW	19	22,896,130 (GRCm39)	missense	probably damaging	0.99
R5108:Trpm3	UTSW	19	22,882,078 (GRCm39)	missense	probably benign	0.06
R5204:Trpm3	UTSW	19	22,425,705 (GRCm39)	nonsense	probably null
R5213:Trpm3	UTSW	19	22,674,818 (GRCm39)	nonsense	probably null
R5358:Trpm3	UTSW	19	22,903,332 (GRCm39)	missense	probably damaging	1.00
R5374:Trpm3	UTSW	19	22,903,548 (GRCm39)	nonsense	probably null
R5382:Trpm3	UTSW	19	22,862,705 (GRCm39)	splice site	probably null
R5509:Trpm3	UTSW	19	22,964,622 (GRCm39)	missense	probably damaging	0.99
R5558:Trpm3	UTSW	19	22,955,937 (GRCm39)	missense	probably damaging	1.00
R6154:Trpm3	UTSW	19	22,965,178 (GRCm39)	missense	probably damaging	1.00
R6250:Trpm3	UTSW	19	22,887,418 (GRCm39)	missense	probably benign	0.01
R6433:Trpm3	UTSW	19	22,878,669 (GRCm39)	missense	probably damaging	1.00
R6542:Trpm3	UTSW	19	22,903,477 (GRCm39)	missense	probably benign	0.04
R6630:Trpm3	UTSW	19	22,965,347 (GRCm39)	missense	probably benign	0.00
R6640:Trpm3	UTSW	19	22,955,946 (GRCm39)	missense	probably damaging	1.00
R6725:Trpm3	UTSW	19	22,903,392 (GRCm39)	missense	probably damaging	1.00
R7275:Trpm3	UTSW	19	22,956,048 (GRCm39)	missense	possibly damaging	0.71
R7371:Trpm3	UTSW	19	22,879,557 (GRCm39)	missense	probably benign	0.27
R7467:Trpm3	UTSW	19	22,955,698 (GRCm39)	missense	possibly damaging	0.82
R7488:Trpm3	UTSW	19	22,955,937 (GRCm39)	missense	probably damaging	1.00
R7495:Trpm3	UTSW	19	22,875,160 (GRCm39)	missense	probably benign	0.28
R7600:Trpm3	UTSW	19	22,903,458 (GRCm39)	missense	possibly damaging	0.68
R7710:Trpm3	UTSW	19	22,896,154 (GRCm39)	missense	probably damaging	0.97
R7877:Trpm3	UTSW	19	22,882,148 (GRCm39)	missense	probably benign	0.25
R8184:Trpm3	UTSW	19	22,896,060 (GRCm39)	missense	possibly damaging	0.46
R8234:Trpm3	UTSW	19	22,692,640 (GRCm39)	missense	possibly damaging	0.47
R8236:Trpm3	UTSW	19	22,964,772 (GRCm39)	missense	probably benign	0.00
R8443:Trpm3	UTSW	19	22,676,226 (GRCm39)	missense	possibly damaging	0.90
R8470:Trpm3	UTSW	19	22,887,501 (GRCm39)	missense	possibly damaging	0.91
R8784:Trpm3	UTSW	19	22,896,040 (GRCm39)	missense	probably benign	0.07
R8816:Trpm3	UTSW	19	22,965,580 (GRCm39)	missense	probably damaging	0.97
R8818:Trpm3	UTSW	19	22,955,952 (GRCm39)	missense	possibly damaging	0.81
R8875:Trpm3	UTSW	19	22,887,493 (GRCm39)	missense	probably damaging	1.00
R8931:Trpm3	UTSW	19	22,744,034 (GRCm39)	missense	probably damaging	1.00
R8969:Trpm3	UTSW	19	22,903,308 (GRCm39)	missense	probably damaging	0.98
R8987:Trpm3	UTSW	19	22,896,124 (GRCm39)	missense	probably damaging	1.00
R9300:Trpm3	UTSW	19	22,955,745 (GRCm39)	missense	possibly damaging	0.49
R9327:Trpm3	UTSW	19	22,896,004 (GRCm39)	missense	possibly damaging	0.56
R9354:Trpm3	UTSW	19	22,425,696 (GRCm39)	missense	probably benign
R9514:Trpm3	UTSW	19	22,960,040 (GRCm39)	missense	probably benign	0.42
R9545:Trpm3	UTSW	19	22,878,458 (GRCm39)	missense	probably benign	0.24
R9712:Trpm3	UTSW	19	22,692,716 (GRCm39)	missense	possibly damaging	0.55
R9721:Trpm3	UTSW	19	22,866,762 (GRCm39)	missense	probably benign	0.00
R9750:Trpm3	UTSW	19	22,903,495 (GRCm39)	missense	probably benign	0.00
Z1176:Trpm3	UTSW	19	22,964,854 (GRCm39)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGTGGTGGCCCTTTGAATATTC -3'
(R):5'- GAAGTATTGGCTCCCTCTGC -3'

Sequencing Primer
(F):5'- GTGGCCCTTTGAATATTCATGAAG -3'
(R):5'- GCCTGCTGCCCATCCATC -3'

Posted On

2015-07-06