Incidental Mutation 'R4366:Mbd5'
ID325730
Institutional Source Beutler Lab
Gene Symbol Mbd5
Ensembl Gene ENSMUSG00000036792
Gene Namemethyl-CpG binding domain protein 5
SynonymsC030040A15Rik, OTTMUSG00000012483, 9430004D19Rik
MMRRC Submission 041114-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4366 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location48949508-49325405 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49272966 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 261 (N261K)
Ref Sequence ENSEMBL: ENSMUSP00000137021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047413] [ENSMUST00000112754] [ENSMUST00000132717]
Predicted Effect probably damaging
Transcript: ENSMUST00000047413
AA Change: N1153K

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000036847
Gene: ENSMUSG00000036792
AA Change: N1153K

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Blast:MBD 24 77 9e-11 BLAST
low complexity region 332 342 N/A INTRINSIC
low complexity region 429 443 N/A INTRINSIC
low complexity region 459 467 N/A INTRINSIC
low complexity region 499 512 N/A INTRINSIC
low complexity region 535 546 N/A INTRINSIC
low complexity region 571 613 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
low complexity region 912 932 N/A INTRINSIC
low complexity region 934 948 N/A INTRINSIC
low complexity region 992 1010 N/A INTRINSIC
low complexity region 1020 1035 N/A INTRINSIC
low complexity region 1112 1136 N/A INTRINSIC
low complexity region 1173 1184 N/A INTRINSIC
low complexity region 1206 1229 N/A INTRINSIC
low complexity region 1552 1562 N/A INTRINSIC
SCOP:d1khca_ 1615 1718 2e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112754
SMART Domains Protein: ENSMUSP00000108374
Gene: ENSMUSG00000036792

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Blast:MBD 24 77 8e-11 BLAST
low complexity region 332 342 N/A INTRINSIC
low complexity region 429 443 N/A INTRINSIC
low complexity region 459 467 N/A INTRINSIC
low complexity region 499 512 N/A INTRINSIC
low complexity region 535 546 N/A INTRINSIC
low complexity region 571 613 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
low complexity region 912 932 N/A INTRINSIC
low complexity region 934 948 N/A INTRINSIC
low complexity region 976 999 N/A INTRINSIC
low complexity region 1322 1332 N/A INTRINSIC
SCOP:d1khca_ 1385 1488 4e-17 SMART
Predicted Effect unknown
Transcript: ENSMUST00000122841
AA Change: N892K
SMART Domains Protein: ENSMUSP00000119317
Gene: ENSMUSG00000036792
AA Change: N892K

DomainStartEndE-ValueType
low complexity region 72 82 N/A INTRINSIC
low complexity region 169 183 N/A INTRINSIC
low complexity region 199 207 N/A INTRINSIC
low complexity region 239 252 N/A INTRINSIC
low complexity region 275 286 N/A INTRINSIC
low complexity region 311 353 N/A INTRINSIC
low complexity region 439 459 N/A INTRINSIC
low complexity region 581 592 N/A INTRINSIC
low complexity region 652 672 N/A INTRINSIC
low complexity region 674 688 N/A INTRINSIC
low complexity region 732 750 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 852 876 N/A INTRINSIC
low complexity region 913 924 N/A INTRINSIC
low complexity region 946 969 N/A INTRINSIC
low complexity region 1011 1022 N/A INTRINSIC
low complexity region 1056 1064 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132717
AA Change: N261K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000137021
Gene: ENSMUSG00000036792
AA Change: N261K

DomainStartEndE-ValueType
low complexity region 20 40 N/A INTRINSIC
low complexity region 42 56 N/A INTRINSIC
low complexity region 100 118 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
low complexity region 220 244 N/A INTRINSIC
low complexity region 281 292 N/A INTRINSIC
low complexity region 314 337 N/A INTRINSIC
low complexity region 379 390 N/A INTRINSIC
low complexity region 424 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199257
Meta Mutation Damage Score 0.0744 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the methyl-CpG-binding domain (MBD) family. The MBD consists of about 70 residues and is the minimal region required for a methyl-CpG-binding protein binding specifically to methylated DNA. In addition to the MBD domain, this protein contains a PWWP domain (Pro-Trp-Trp-Pro motif), which consists of 100-150 amino acids and is found in numerous proteins that are involved in cell division, growth and differentiation. Mutations in this gene cause mental retardation autosomal dominant type 1. Haploinsufficiency of this gene is associated with a syndrome involving microcephaly, intellectual disabilities, severe speech impairment, and seizures. Alternatively spliced transcript variants have been found, but their full-length nature is not determined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozgyous for a knock-out allele exhibit severe postnatal growth retardation leading to lethality by P22, decreased body, brain and liver weights, reduced IGF-I and GH levels, and abnormal glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 A C 17: 43,441,969 T396P probably damaging Het
Apob A T 12: 8,016,083 I4318F possibly damaging Het
Apol7c T G 15: 77,526,389 D119A probably benign Het
App G T 16: 85,056,433 D252E unknown Het
C4a T A 17: 34,814,908 noncoding transcript Het
Cacna1b T C 2: 24,702,620 Y515C probably damaging Het
Cacna1f G T X: 7,609,974 A123S probably damaging Het
Cldn6 G C 17: 23,681,520 A153P probably benign Het
Cmya5 T C 13: 93,091,956 N2208S probably benign Het
Csnk1g1 A G 9: 66,019,853 T101A probably benign Het
Ddx46 T A 13: 55,663,236 D544E probably benign Het
Dmxl1 T A 18: 49,878,017 C1080* probably null Het
Dst T C 1: 34,251,878 S3335P probably damaging Het
Efnb3 T C 11: 69,555,945 K313R probably damaging Het
Elf2 G A 3: 51,308,149 Q47* probably null Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Epc2 A G 2: 49,547,554 K657E possibly damaging Het
Ephx4 A G 5: 107,403,813 probably benign Het
Ereg T C 5: 91,086,800 I24T probably benign Het
Evc2 C A 5: 37,338,669 A41D possibly damaging Het
Fkbp15 A G 4: 62,336,414 V283A probably benign Het
Flrt3 T C 2: 140,660,407 T434A probably damaging Het
Gm572 A G 4: 148,654,865 D50G possibly damaging Het
Hecw1 C T 13: 14,316,164 D748N probably damaging Het
Hivep3 A C 4: 120,096,089 H534P possibly damaging Het
Hspa4l C A 3: 40,766,809 probably null Het
Ipo7 T C 7: 110,029,712 M63T possibly damaging Het
Ipo7 A T 7: 110,048,216 T614S possibly damaging Het
Krt83 T G 15: 101,487,514 M326L probably benign Het
Mcam T A 9: 44,134,697 L3Q probably damaging Het
Mcoln3 C A 3: 146,140,492 T519K possibly damaging Het
Mrgprx1 C A 7: 48,021,193 A269S probably damaging Het
Mypn T C 10: 63,192,708 E192G probably benign Het
Nup205 C A 6: 35,192,027 P397Q probably benign Het
Obsl1 A C 1: 75,488,049 L1576R possibly damaging Het
Ofcc1 A G 13: 40,015,461 S817P probably benign Het
Olfr800 A T 10: 129,660,531 M242L probably benign Het
Olfr876 A T 9: 37,804,190 H93L probably benign Het
Pcdhgb7 A G 18: 37,754,072 Y765C possibly damaging Het
Pde7a A G 3: 19,310,862 probably null Het
Phip C T 9: 82,900,869 probably benign Het
Rhbdl2 T A 4: 123,809,935 M1K probably null Het
Ripor2 C T 13: 24,721,711 P947S probably benign Het
Sf3a3 A G 4: 124,725,139 T298A probably benign Het
Slc25a29 C T 12: 108,831,171 probably benign Het
Spinkl T G 18: 44,174,583 T4P possibly damaging Het
Stk33 G A 7: 109,279,795 S449L probably benign Het
Suz12 T A 11: 80,002,162 probably benign Het
Timp2 T A 11: 118,310,671 I124F probably damaging Het
Tlr1 C T 5: 64,925,837 D466N probably benign Het
Tmem200b A G 4: 131,922,470 I234V possibly damaging Het
Ubr1 C A 2: 120,970,603 probably benign Het
Usp33 C A 3: 152,368,512 Q332K probably benign Het
Zfr A G 15: 12,156,330 E634G probably damaging Het
Other mutations in Mbd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01385:Mbd5 APN 2 49250221 missense possibly damaging 0.92
IGL01481:Mbd5 APN 2 49278939 missense possibly damaging 0.90
IGL01639:Mbd5 APN 2 49272308 missense probably damaging 0.98
IGL02063:Mbd5 APN 2 49274767 missense probably damaging 1.00
IGL02157:Mbd5 APN 2 49278975 missense probably benign
IGL02510:Mbd5 APN 2 49257029 missense probably benign 0.05
IGL02932:Mbd5 APN 2 49279448 missense possibly damaging 0.66
IGL02973:Mbd5 APN 2 49313709 missense probably damaging 0.99
IGL03189:Mbd5 APN 2 49257751 missense probably damaging 0.98
F5770:Mbd5 UTSW 2 49316410 missense probably damaging 0.99
R0391:Mbd5 UTSW 2 49272416 missense possibly damaging 0.90
R0427:Mbd5 UTSW 2 49279079 missense probably benign 0.27
R0544:Mbd5 UTSW 2 49257209 missense possibly damaging 0.54
R0883:Mbd5 UTSW 2 49256689 missense possibly damaging 0.94
R1072:Mbd5 UTSW 2 49257191 missense probably damaging 1.00
R1099:Mbd5 UTSW 2 49258144 missense probably benign 0.06
R1400:Mbd5 UTSW 2 49274776 critical splice donor site probably null
R1497:Mbd5 UTSW 2 49257381 missense possibly damaging 0.73
R1552:Mbd5 UTSW 2 49272934 missense probably damaging 0.99
R1675:Mbd5 UTSW 2 49256218 missense possibly damaging 0.90
R1710:Mbd5 UTSW 2 49257032 missense probably benign 0.10
R2085:Mbd5 UTSW 2 49279311 missense possibly damaging 0.90
R2252:Mbd5 UTSW 2 49257686 missense probably damaging 1.00
R2473:Mbd5 UTSW 2 49279341 missense probably benign 0.06
R3966:Mbd5 UTSW 2 49272070 missense possibly damaging 0.46
R4278:Mbd5 UTSW 2 49272293 missense probably damaging 0.97
R4348:Mbd5 UTSW 2 49256327 missense probably benign
R4428:Mbd5 UTSW 2 49279764 missense possibly damaging 0.94
R4556:Mbd5 UTSW 2 49279394 missense probably damaging 1.00
R4600:Mbd5 UTSW 2 49257197 missense probably benign 0.31
R4689:Mbd5 UTSW 2 49258279 missense possibly damaging 0.46
R4707:Mbd5 UTSW 2 49250156 missense probably damaging 0.99
R4718:Mbd5 UTSW 2 49256402 missense possibly damaging 0.66
R4773:Mbd5 UTSW 2 49274611 missense probably damaging 1.00
R4846:Mbd5 UTSW 2 49256997 missense probably damaging 1.00
R5015:Mbd5 UTSW 2 49258196 missense possibly damaging 0.92
R5059:Mbd5 UTSW 2 49256455 missense probably damaging 0.96
R5268:Mbd5 UTSW 2 49272094 missense possibly damaging 0.92
R5479:Mbd5 UTSW 2 49272905 missense probably damaging 0.99
R5579:Mbd5 UTSW 2 49272814 missense possibly damaging 0.94
R5591:Mbd5 UTSW 2 49274669 missense probably damaging 1.00
R5876:Mbd5 UTSW 2 49274645 missense probably damaging 0.98
R5886:Mbd5 UTSW 2 49272452 missense probably damaging 1.00
R5973:Mbd5 UTSW 2 49272389 missense probably benign 0.23
R6935:Mbd5 UTSW 2 49279812 missense probably damaging 0.97
R7317:Mbd5 UTSW 2 49279743 missense probably benign
R7366:Mbd5 UTSW 2 49274568 missense probably benign
R7385:Mbd5 UTSW 2 49272449 missense probably benign 0.01
R7402:Mbd5 UTSW 2 49257554 missense probably damaging 1.00
R7462:Mbd5 UTSW 2 49257880 missense possibly damaging 0.52
R7549:Mbd5 UTSW 2 49251343 missense probably damaging 0.97
V7583:Mbd5 UTSW 2 49316410 missense probably damaging 0.99
Z1176:Mbd5 UTSW 2 49279308 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AATGGCCTTGAATCCCCAGC -3'
(R):5'- GTTCAGGTGGCATCAGAATTAGAAG -3'

Sequencing Primer
(F):5'- GCCTTGAATCCCCAGCTGTTG -3'
(R):5'- GGAAGCAGATTACAGTGGTATTTAG -3'
Posted On2015-07-06