Incidental Mutation 'R4366:Mcoln3'
ID325738
Institutional Source Beutler Lab
Gene Symbol Mcoln3
Ensembl Gene ENSMUSG00000036853
Gene Namemucolipin 3
Synonymsvaritint-waddler, Va, 6720490O21Rik, TRPML3
MMRRC Submission 041114-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R4366 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location146117450-146141806 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 146140492 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 519 (T519K)
Ref Sequence ENSEMBL: ENSMUSP00000038801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039450]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039450
AA Change: T519K

PolyPhen 2 Score 0.758 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000038801
Gene: ENSMUSG00000036853
AA Change: T519K

DomainStartEndE-ValueType
low complexity region 24 29 N/A INTRINSIC
transmembrane domain 286 308 N/A INTRINSIC
transmembrane domain 335 357 N/A INTRINSIC
Pfam:PKD_channel 360 508 3.5e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146689
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of members of the mucolipin cation channel proteins. Mutation studies of the highly similar protein in mice have shown that the protein is found in cochlea hair cells, and mutant mice show early-onset hearing loss and balance problems. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Heterozygotes show normal/diluted/white hair patches, circling, hyperactivity, deafness, and reduced fertility. Homozygotes are white with small patches of color and show severe behavioral abnormalities, poor postnatal viability and are nearly infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 A C 17: 43,441,969 T396P probably damaging Het
Apob A T 12: 8,016,083 I4318F possibly damaging Het
Apol7c T G 15: 77,526,389 D119A probably benign Het
App G T 16: 85,056,433 D252E unknown Het
C4a T A 17: 34,814,908 noncoding transcript Het
Cacna1b T C 2: 24,702,620 Y515C probably damaging Het
Cacna1f G T X: 7,609,974 A123S probably damaging Het
Cldn6 G C 17: 23,681,520 A153P probably benign Het
Cmya5 T C 13: 93,091,956 N2208S probably benign Het
Csnk1g1 A G 9: 66,019,853 T101A probably benign Het
Ddx46 T A 13: 55,663,236 D544E probably benign Het
Dmxl1 T A 18: 49,878,017 C1080* probably null Het
Dst T C 1: 34,251,878 S3335P probably damaging Het
Efnb3 T C 11: 69,555,945 K313R probably damaging Het
Elf2 G A 3: 51,308,149 Q47* probably null Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Epc2 A G 2: 49,547,554 K657E possibly damaging Het
Ephx4 A G 5: 107,403,813 probably benign Het
Ereg T C 5: 91,086,800 I24T probably benign Het
Evc2 C A 5: 37,338,669 A41D possibly damaging Het
Fkbp15 A G 4: 62,336,414 V283A probably benign Het
Flrt3 T C 2: 140,660,407 T434A probably damaging Het
Gm572 A G 4: 148,654,865 D50G possibly damaging Het
Hecw1 C T 13: 14,316,164 D748N probably damaging Het
Hivep3 A C 4: 120,096,089 H534P possibly damaging Het
Hspa4l C A 3: 40,766,809 probably null Het
Ipo7 T C 7: 110,029,712 M63T possibly damaging Het
Ipo7 A T 7: 110,048,216 T614S possibly damaging Het
Krt83 T G 15: 101,487,514 M326L probably benign Het
Mbd5 T A 2: 49,272,966 N261K probably damaging Het
Mcam T A 9: 44,134,697 L3Q probably damaging Het
Mrgprx1 C A 7: 48,021,193 A269S probably damaging Het
Mypn T C 10: 63,192,708 E192G probably benign Het
Nup205 C A 6: 35,192,027 P397Q probably benign Het
Obsl1 A C 1: 75,488,049 L1576R possibly damaging Het
Ofcc1 A G 13: 40,015,461 S817P probably benign Het
Olfr800 A T 10: 129,660,531 M242L probably benign Het
Olfr876 A T 9: 37,804,190 H93L probably benign Het
Pcdhgb7 A G 18: 37,754,072 Y765C possibly damaging Het
Pde7a A G 3: 19,310,862 probably null Het
Phip C T 9: 82,900,869 probably benign Het
Rhbdl2 T A 4: 123,809,935 M1K probably null Het
Ripor2 C T 13: 24,721,711 P947S probably benign Het
Sf3a3 A G 4: 124,725,139 T298A probably benign Het
Slc25a29 C T 12: 108,831,171 probably benign Het
Spinkl T G 18: 44,174,583 T4P possibly damaging Het
Stk33 G A 7: 109,279,795 S449L probably benign Het
Suz12 T A 11: 80,002,162 probably benign Het
Timp2 T A 11: 118,310,671 I124F probably damaging Het
Tlr1 C T 5: 64,925,837 D466N probably benign Het
Tmem200b A G 4: 131,922,470 I234V possibly damaging Het
Ubr1 C A 2: 120,970,603 probably benign Het
Usp33 C A 3: 152,368,512 Q332K probably benign Het
Zfr A G 15: 12,156,330 E634G probably damaging Het
Other mutations in Mcoln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Mcoln3 APN 3 146133928 missense probably damaging 1.00
IGL01106:Mcoln3 APN 3 146137264 missense probably benign 0.01
IGL01712:Mcoln3 APN 3 146128264 unclassified probably benign
IGL02115:Mcoln3 APN 3 146137301 missense probably damaging 0.99
IGL02116:Mcoln3 APN 3 146133909 missense probably benign 0.29
P4717OSA:Mcoln3 UTSW 3 146124749 missense probably damaging 0.99
R0463:Mcoln3 UTSW 3 146140576 nonsense probably null
R1981:Mcoln3 UTSW 3 146140590 nonsense probably null
R2056:Mcoln3 UTSW 3 146128224 missense probably benign 0.01
R3000:Mcoln3 UTSW 3 146133907 missense possibly damaging 0.62
R4667:Mcoln3 UTSW 3 146131204 missense probably benign 0.01
R4950:Mcoln3 UTSW 3 146139519 missense probably damaging 0.96
R5457:Mcoln3 UTSW 3 146128122 missense probably benign 0.00
R6302:Mcoln3 UTSW 3 146124772 missense probably benign 0.00
R6353:Mcoln3 UTSW 3 146131154 missense probably damaging 0.99
R6632:Mcoln3 UTSW 3 146128187 missense probably benign
R6915:Mcoln3 UTSW 3 146137256 critical splice acceptor site probably null
R7790:Mcoln3 UTSW 3 146139492 missense probably damaging 1.00
R7838:Mcoln3 UTSW 3 146139475 missense probably damaging 1.00
R7861:Mcoln3 UTSW 3 146124791 missense possibly damaging 0.95
Z1176:Mcoln3 UTSW 3 146140466 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTACTGCAGAGTCTCAGGAC -3'
(R):5'- GTTGCGTGATCACAAATAATCTCTGG -3'

Sequencing Primer
(F):5'- GCAGAGTCTCAGGACCATTTAACTTC -3'
(R):5'- GTGATCACAAATAATCTCTGGCTCAG -3'
Posted On2015-07-06