Incidental Mutation 'R4366:Sf3a3'
ID325743
Institutional Source Beutler Lab
Gene Symbol Sf3a3
Ensembl Gene ENSMUSG00000028902
Gene Namesplicing factor 3a, subunit 3
Synonyms4930512K19Rik, 60kDa
MMRRC Submission 041114-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R4366 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location124714776-124732460 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124725139 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 298 (T298A)
Ref Sequence ENSEMBL: ENSMUSP00000030734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030734]
Predicted Effect probably benign
Transcript: ENSMUST00000030734
AA Change: T298A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030734
Gene: ENSMUSG00000028902
AA Change: T298A

DomainStartEndE-ValueType
Pfam:SF3a60_bindingd 74 100 3e-19 PFAM
Pfam:SF3A3 129 207 7.9e-27 PFAM
Pfam:Telomere_Sde2_2 244 303 3.1e-31 PFAM
low complexity region 354 377 N/A INTRINSIC
ZnF_C2H2 406 431 9.3e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151049
Meta Mutation Damage Score 0.0605 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes subunit 3 of the splicing factor 3a protein complex. The splicing factor 3a heterotrimer includes subunits 1, 2 and 3 and is necessary for the in vitro conversion of 15S U2 snRNP into an active 17S particle that performs pre-mRNA splicing. Subunit 3 interacts with subunit 1 through its amino-terminus while the zinc finger domain of subunit 3 plays a role in its binding to the 15S U2 snRNP. This gene has a pseudogene on chromosome 20. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 A C 17: 43,441,969 T396P probably damaging Het
Apob A T 12: 8,016,083 I4318F possibly damaging Het
Apol7c T G 15: 77,526,389 D119A probably benign Het
App G T 16: 85,056,433 D252E unknown Het
C4a T A 17: 34,814,908 noncoding transcript Het
Cacna1b T C 2: 24,702,620 Y515C probably damaging Het
Cacna1f G T X: 7,609,974 A123S probably damaging Het
Cldn6 G C 17: 23,681,520 A153P probably benign Het
Cmya5 T C 13: 93,091,956 N2208S probably benign Het
Csnk1g1 A G 9: 66,019,853 T101A probably benign Het
Ddx46 T A 13: 55,663,236 D544E probably benign Het
Dmxl1 T A 18: 49,878,017 C1080* probably null Het
Dst T C 1: 34,251,878 S3335P probably damaging Het
Efnb3 T C 11: 69,555,945 K313R probably damaging Het
Elf2 G A 3: 51,308,149 Q47* probably null Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Epc2 A G 2: 49,547,554 K657E possibly damaging Het
Ephx4 A G 5: 107,403,813 probably benign Het
Ereg T C 5: 91,086,800 I24T probably benign Het
Evc2 C A 5: 37,338,669 A41D possibly damaging Het
Fkbp15 A G 4: 62,336,414 V283A probably benign Het
Flrt3 T C 2: 140,660,407 T434A probably damaging Het
Gm572 A G 4: 148,654,865 D50G possibly damaging Het
Hecw1 C T 13: 14,316,164 D748N probably damaging Het
Hivep3 A C 4: 120,096,089 H534P possibly damaging Het
Hspa4l C A 3: 40,766,809 probably null Het
Ipo7 T C 7: 110,029,712 M63T possibly damaging Het
Ipo7 A T 7: 110,048,216 T614S possibly damaging Het
Krt83 T G 15: 101,487,514 M326L probably benign Het
Mbd5 T A 2: 49,272,966 N261K probably damaging Het
Mcam T A 9: 44,134,697 L3Q probably damaging Het
Mcoln3 C A 3: 146,140,492 T519K possibly damaging Het
Mrgprx1 C A 7: 48,021,193 A269S probably damaging Het
Mypn T C 10: 63,192,708 E192G probably benign Het
Nup205 C A 6: 35,192,027 P397Q probably benign Het
Obsl1 A C 1: 75,488,049 L1576R possibly damaging Het
Ofcc1 A G 13: 40,015,461 S817P probably benign Het
Olfr800 A T 10: 129,660,531 M242L probably benign Het
Olfr876 A T 9: 37,804,190 H93L probably benign Het
Pcdhgb7 A G 18: 37,754,072 Y765C possibly damaging Het
Pde7a A G 3: 19,310,862 probably null Het
Phip C T 9: 82,900,869 probably benign Het
Rhbdl2 T A 4: 123,809,935 M1K probably null Het
Ripor2 C T 13: 24,721,711 P947S probably benign Het
Slc25a29 C T 12: 108,831,171 probably benign Het
Spinkl T G 18: 44,174,583 T4P possibly damaging Het
Stk33 G A 7: 109,279,795 S449L probably benign Het
Suz12 T A 11: 80,002,162 probably benign Het
Timp2 T A 11: 118,310,671 I124F probably damaging Het
Tlr1 C T 5: 64,925,837 D466N probably benign Het
Tmem200b A G 4: 131,922,470 I234V possibly damaging Het
Ubr1 C A 2: 120,970,603 probably benign Het
Usp33 C A 3: 152,368,512 Q332K probably benign Het
Zfr A G 15: 12,156,330 E634G probably damaging Het
Other mutations in Sf3a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Sf3a3 APN 4 124718343 missense possibly damaging 0.93
IGL01623:Sf3a3 APN 4 124718343 missense possibly damaging 0.93
PIT4495001:Sf3a3 UTSW 4 124728320 missense probably damaging 1.00
R0070:Sf3a3 UTSW 4 124714955 missense probably benign 0.04
R1441:Sf3a3 UTSW 4 124725142 missense probably damaging 0.99
R1858:Sf3a3 UTSW 4 124729495 missense probably damaging 1.00
R1928:Sf3a3 UTSW 4 124722093 missense possibly damaging 0.56
R1943:Sf3a3 UTSW 4 124715901 missense possibly damaging 0.95
R2101:Sf3a3 UTSW 4 124718343 missense possibly damaging 0.93
R2984:Sf3a3 UTSW 4 124718409 missense probably damaging 1.00
R3434:Sf3a3 UTSW 4 124725077 missense possibly damaging 0.95
R4711:Sf3a3 UTSW 4 124728181 missense probably benign 0.01
R5032:Sf3a3 UTSW 4 124725166 missense probably benign 0.17
R5464:Sf3a3 UTSW 4 124728240 critical splice donor site probably null
R5607:Sf3a3 UTSW 4 124714953 missense probably damaging 1.00
R5997:Sf3a3 UTSW 4 124722058 missense probably damaging 0.99
R6166:Sf3a3 UTSW 4 124723384 intron probably benign
R7030:Sf3a3 UTSW 4 124722880 missense probably damaging 1.00
R7038:Sf3a3 UTSW 4 124728426 missense probably benign 0.16
R7157:Sf3a3 UTSW 4 124722900 missense probably damaging 0.98
R7184:Sf3a3 UTSW 4 124714979 missense probably benign 0.10
R7250:Sf3a3 UTSW 4 124722915 missense probably benign 0.03
Z1176:Sf3a3 UTSW 4 124714901 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TTGATTGCCCCAAACTGTCAAAATC -3'
(R):5'- GCTTGAGGCCAATCTGAGTTATGG -3'

Sequencing Primer
(F):5'- GGTGAATGCCTTTAACCCCAG -3'
(R):5'- CCAATCTGAGTTATGGGAGAGCCTG -3'
Posted On2015-07-06