Incidental Mutation 'R4366:Tmem200b'
ID325744
Institutional Source Beutler Lab
Gene Symbol Tmem200b
Ensembl Gene ENSMUSG00000070720
Gene Nametransmembrane protein 200B
SynonymsEG623230
MMRRC Submission 041114-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.381) question?
Stock #R4366 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location131921771-131923140 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 131922470 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 234 (I234V)
Ref Sequence ENSEMBL: ENSMUSP00000092253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030739] [ENSMUST00000054917] [ENSMUST00000084253] [ENSMUST00000094666] [ENSMUST00000105970] [ENSMUST00000105972] [ENSMUST00000105974] [ENSMUST00000105975] [ENSMUST00000105981] [ENSMUST00000137846]
Predicted Effect probably benign
Transcript: ENSMUST00000030739
SMART Domains Protein: ENSMUSP00000030739
Gene: ENSMUSG00000028906

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
low complexity region 594 607 N/A INTRINSIC
Pfam:SAB 661 709 1.8e-29 PFAM
Pfam:4_1_CTD 741 855 3.5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054917
SMART Domains Protein: ENSMUSP00000060375
Gene: ENSMUSG00000028906

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
Pfam:SAB 607 655 2.3e-28 PFAM
Pfam:4_1_CTD 687 801 3.2e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084253
SMART Domains Protein: ENSMUSP00000081274
Gene: ENSMUSG00000028906

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
Pfam:SAB 607 655 2.3e-28 PFAM
Pfam:4_1_CTD 687 801 3.2e-57 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000094666
AA Change: I234V

PolyPhen 2 Score 0.527 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000092253
Gene: ENSMUSG00000070720
AA Change: I234V

DomainStartEndE-ValueType
Pfam:DUF2371 14 92 8.8e-13 PFAM
Pfam:DUF2371 86 131 7.6e-17 PFAM
low complexity region 172 187 N/A INTRINSIC
low complexity region 204 216 N/A INTRINSIC
low complexity region 240 250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105970
SMART Domains Protein: ENSMUSP00000101590
Gene: ENSMUSG00000028906

DomainStartEndE-ValueType
B41 55 250 1.3e-80 SMART
FERM_C 254 344 1.01e-35 SMART
FA 347 393 8.99e-19 SMART
low complexity region 437 459 N/A INTRINSIC
Pfam:SAB 476 524 1.1e-29 PFAM
Pfam:4_1_CTD 578 636 1.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105972
SMART Domains Protein: ENSMUSP00000101592
Gene: ENSMUSG00000028906

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
low complexity region 594 607 N/A INTRINSIC
Pfam:SAB 661 709 1.8e-29 PFAM
Pfam:4_1_CTD 741 855 3.5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105974
SMART Domains Protein: ENSMUSP00000101594
Gene: ENSMUSG00000028906

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 367 3.77e-50 SMART
FERM_C 371 461 1.01e-35 SMART
FA 464 510 8.99e-19 SMART
Pfam:SAB 572 620 2e-28 PFAM
Pfam:4_1_CTD 652 766 3e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105975
SMART Domains Protein: ENSMUSP00000101595
Gene: ENSMUSG00000028906

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 232 427 1.3e-80 SMART
FERM_C 431 521 1.01e-35 SMART
FA 524 570 8.99e-19 SMART
low complexity region 619 632 N/A INTRINSIC
Pfam:SAB 672 720 3.9e-25 PFAM
Pfam:4_1_CTD 758 865 2.6e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105981
SMART Domains Protein: ENSMUSP00000101601
Gene: ENSMUSG00000028906

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
low complexity region 594 607 N/A INTRINSIC
Pfam:SAB 661 709 1.8e-29 PFAM
Pfam:4_1_CTD 741 855 3.5e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124738
Predicted Effect probably benign
Transcript: ENSMUST00000135579
SMART Domains Protein: ENSMUSP00000121764
Gene: ENSMUSG00000028906

DomainStartEndE-ValueType
Pfam:SAB 28 76 2e-24 PFAM
low complexity region 148 159 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
Pfam:4_1_CTD 264 371 6.6e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137846
SMART Domains Protein: ENSMUSP00000123623
Gene: ENSMUSG00000028906

DomainStartEndE-ValueType
B41 49 244 1.3e-80 SMART
FERM_C 248 338 1.01e-35 SMART
FA 341 387 8.99e-19 SMART
low complexity region 431 453 N/A INTRINSIC
Pfam:SAB 470 518 1.2e-29 PFAM
Pfam:4_1_CTD 550 664 2.5e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146021
Predicted Effect probably benign
Transcript: ENSMUST00000146443
SMART Domains Protein: ENSMUSP00000122234
Gene: ENSMUSG00000028906

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
Pfam:SAB 53 101 7e-26 PFAM
Pfam:4_1_CTD 139 246 2.8e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151746
Predicted Effect probably benign
Transcript: ENSMUST00000155990
SMART Domains Protein: ENSMUSP00000116599
Gene: ENSMUSG00000028906

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
Pfam:4_1_CTD 86 193 1.5e-52 PFAM
Meta Mutation Damage Score 0.0661 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 95% (57/60)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 A C 17: 43,441,969 T396P probably damaging Het
Apob A T 12: 8,016,083 I4318F possibly damaging Het
Apol7c T G 15: 77,526,389 D119A probably benign Het
App G T 16: 85,056,433 D252E unknown Het
C4a T A 17: 34,814,908 noncoding transcript Het
Cacna1b T C 2: 24,702,620 Y515C probably damaging Het
Cacna1f G T X: 7,609,974 A123S probably damaging Het
Cldn6 G C 17: 23,681,520 A153P probably benign Het
Cmya5 T C 13: 93,091,956 N2208S probably benign Het
Csnk1g1 A G 9: 66,019,853 T101A probably benign Het
Ddx46 T A 13: 55,663,236 D544E probably benign Het
Dmxl1 T A 18: 49,878,017 C1080* probably null Het
Dst T C 1: 34,251,878 S3335P probably damaging Het
Efnb3 T C 11: 69,555,945 K313R probably damaging Het
Elf2 G A 3: 51,308,149 Q47* probably null Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Epc2 A G 2: 49,547,554 K657E possibly damaging Het
Ephx4 A G 5: 107,403,813 probably benign Het
Ereg T C 5: 91,086,800 I24T probably benign Het
Evc2 C A 5: 37,338,669 A41D possibly damaging Het
Fkbp15 A G 4: 62,336,414 V283A probably benign Het
Flrt3 T C 2: 140,660,407 T434A probably damaging Het
Gm572 A G 4: 148,654,865 D50G possibly damaging Het
Hecw1 C T 13: 14,316,164 D748N probably damaging Het
Hivep3 A C 4: 120,096,089 H534P possibly damaging Het
Hspa4l C A 3: 40,766,809 probably null Het
Ipo7 T C 7: 110,029,712 M63T possibly damaging Het
Ipo7 A T 7: 110,048,216 T614S possibly damaging Het
Krt83 T G 15: 101,487,514 M326L probably benign Het
Mbd5 T A 2: 49,272,966 N261K probably damaging Het
Mcam T A 9: 44,134,697 L3Q probably damaging Het
Mcoln3 C A 3: 146,140,492 T519K possibly damaging Het
Mrgprx1 C A 7: 48,021,193 A269S probably damaging Het
Mypn T C 10: 63,192,708 E192G probably benign Het
Nup205 C A 6: 35,192,027 P397Q probably benign Het
Obsl1 A C 1: 75,488,049 L1576R possibly damaging Het
Ofcc1 A G 13: 40,015,461 S817P probably benign Het
Olfr800 A T 10: 129,660,531 M242L probably benign Het
Olfr876 A T 9: 37,804,190 H93L probably benign Het
Pcdhgb7 A G 18: 37,754,072 Y765C possibly damaging Het
Pde7a A G 3: 19,310,862 probably null Het
Phip C T 9: 82,900,869 probably benign Het
Rhbdl2 T A 4: 123,809,935 M1K probably null Het
Ripor2 C T 13: 24,721,711 P947S probably benign Het
Sf3a3 A G 4: 124,725,139 T298A probably benign Het
Slc25a29 C T 12: 108,831,171 probably benign Het
Spinkl T G 18: 44,174,583 T4P possibly damaging Het
Stk33 G A 7: 109,279,795 S449L probably benign Het
Suz12 T A 11: 80,002,162 probably benign Het
Timp2 T A 11: 118,310,671 I124F probably damaging Het
Tlr1 C T 5: 64,925,837 D466N probably benign Het
Ubr1 C A 2: 120,970,603 probably benign Het
Usp33 C A 3: 152,368,512 Q332K probably benign Het
Zfr A G 15: 12,156,330 E634G probably damaging Het
Other mutations in Tmem200b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Tmem200b APN 4 131922393 missense probably benign 0.00
R5062:Tmem200b UTSW 4 131922537 missense probably damaging 0.98
R7098:Tmem200b UTSW 4 131922393 missense probably benign 0.10
X0057:Tmem200b UTSW 4 131922317 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCCGAAACTTGGGACCTG -3'
(R):5'- ACAATATCCATCCTAGCCTCGGAG -3'

Sequencing Primer
(F):5'- AAACTTGGGACCTGGCCCC -3'
(R):5'- TGGTAGCCTCACAGCAGGTTATAC -3'
Posted On2015-07-06